\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115022018:

Variant ID: vg0115022018 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15022018
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCGTTCAAACCGTTGCTGTCAGCTCCTTAAAATGTTGGTCCCCCAAGTTAATTTTTTTAATGAAACGGCAGGAGGATTGGCATTTGATTAAATTAGC[A/G]
AGGAAGTAAAGATTCCAAAATTTCAAAGAAAATGCCAAGGGGCCAAGAAGACAGTTTACAGTTGTTGCCTTTCTAGTAATTATCTAGTCTCTAAACATGA

Reverse complement sequence

TCATGTTTAGAGACTAGATAATTACTAGAAAGGCAACAACTGTAAACTGTCTTCTTGGCCCCTTGGCATTTTCTTTGAAATTTTGGAATCTTTACTTCCT[T/C]
GCTAATTTAATCAAATGCCAATCCTCCTGCCGTTTCATTAAAAAAATTAACTTGGGGGACCAACATTTTAAGGAGCTGACAGCAACGGTTTGAACGGCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.40% 3.10% 0.38% 62.06% NA
All Indica  2759 5.30% 3.00% 0.47% 91.23% NA
All Japonica  1512 86.20% 0.10% 0.00% 13.69% NA
Aus  269 33.50% 1.90% 1.86% 62.83% NA
Indica I  595 3.00% 0.00% 0.17% 96.81% NA
Indica II  465 7.50% 12.00% 1.29% 79.14% NA
Indica III  913 3.10% 0.70% 0.22% 96.06% NA
Indica Intermediate  786 8.30% 2.70% 0.51% 88.55% NA
Temperate Japonica  767 94.70% 0.00% 0.00% 5.35% NA
Tropical Japonica  504 89.10% 0.00% 0.00% 10.91% NA
Japonica Intermediate  241 53.10% 0.80% 0.00% 46.06% NA
VI/Aromatic  96 39.60% 56.20% 0.00% 4.17% NA
Intermediate  90 56.70% 3.30% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115022018 A -> G LOC_Os01g26960.1 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26980.1 upstream_gene_variant ; 3820.0bp to feature; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26970.5 intron_variant ; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26970.3 intron_variant ; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26970.1 intron_variant ; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26970.2 intron_variant ; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> G LOC_Os01g26970.4 intron_variant ; MODIFIER silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N
vg0115022018 A -> DEL N N silent_mutation Average:7.24; most accessible tissue: Callus, score: 21.988 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115022018 NA 4.87E-08 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 6.95E-54 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 2.91E-07 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 3.87E-06 mr1719 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 4.21E-06 6.74E-09 mr1064_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 5.06E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 3.70E-08 5.15E-59 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 1.81E-07 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018 NA 1.37E-08 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251