\
| Variant ID: vg0115022018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 15022018 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 59. )
GTGCCGTTCAAACCGTTGCTGTCAGCTCCTTAAAATGTTGGTCCCCCAAGTTAATTTTTTTAATGAAACGGCAGGAGGATTGGCATTTGATTAAATTAGC[A/G]
AGGAAGTAAAGATTCCAAAATTTCAAAGAAAATGCCAAGGGGCCAAGAAGACAGTTTACAGTTGTTGCCTTTCTAGTAATTATCTAGTCTCTAAACATGA
TCATGTTTAGAGACTAGATAATTACTAGAAAGGCAACAACTGTAAACTGTCTTCTTGGCCCCTTGGCATTTTCTTTGAAATTTTGGAATCTTTACTTCCT[T/C]
GCTAATTTAATCAAATGCCAATCCTCCTGCCGTTTCATTAAAAAAATTAACTTGGGGGACCAACATTTTAAGGAGCTGACAGCAACGGTTTGAACGGCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.40% | 3.10% | 0.38% | 62.06% | NA |
| All Indica | 2759 | 5.30% | 3.00% | 0.47% | 91.23% | NA |
| All Japonica | 1512 | 86.20% | 0.10% | 0.00% | 13.69% | NA |
| Aus | 269 | 33.50% | 1.90% | 1.86% | 62.83% | NA |
| Indica I | 595 | 3.00% | 0.00% | 0.17% | 96.81% | NA |
| Indica II | 465 | 7.50% | 12.00% | 1.29% | 79.14% | NA |
| Indica III | 913 | 3.10% | 0.70% | 0.22% | 96.06% | NA |
| Indica Intermediate | 786 | 8.30% | 2.70% | 0.51% | 88.55% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 0.00% | 5.35% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 0.00% | 10.91% | NA |
| Japonica Intermediate | 241 | 53.10% | 0.80% | 0.00% | 46.06% | NA |
| VI/Aromatic | 96 | 39.60% | 56.20% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 56.70% | 3.30% | 0.00% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0115022018 | A -> G | LOC_Os01g26960.1 | upstream_gene_variant ; 3634.0bp to feature; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26980.1 | upstream_gene_variant ; 3820.0bp to feature; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26970.5 | intron_variant ; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26970.3 | intron_variant ; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26970.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26970.2 | intron_variant ; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> G | LOC_Os01g26970.4 | intron_variant ; MODIFIER | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| vg0115022018 | A -> DEL | N | N | silent_mutation | Average:7.24; most accessible tissue: Callus, score: 21.988 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0115022018 | NA | 4.87E-08 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 6.95E-54 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 2.91E-07 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 3.87E-06 | mr1719 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | 4.21E-06 | 6.74E-09 | mr1064_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 5.06E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | 3.70E-08 | 5.15E-59 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 1.81E-07 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0115022018 | NA | 1.37E-08 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |