| Variant ID: vg0114940313 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14940313 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAAAAACACATACAGATCAGCACTATAGGTATCGGAACATCTAAAATTGGCATCTATAGTGTTTTCCCCACCTCCATAGACTGAAAATACAAAAAAAG[G/A]
CACCTTTAAGTAACTATAGGTGCTGGTTCAAGAGAAAAACTGACACCTATAATATATTATATGTGTTGGTTAATTGAAAATAAACACTAATAATATAATA
TATTATATTATTAGTGTTTATTTTCAATTAACCAACACATATAATATATTATAGGTGTCAGTTTTTCTCTTGAACCAGCACCTATAGTTACTTAAAGGTG[C/T]
CTTTTTTTGTATTTTCAGTCTATGGAGGTGGGGAAAACACTATAGATGCCAATTTTAGATGTTCCGATACCTATAGTGCTGATCTGTATGTGTTTTTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 5.70% | 2.45% | 39.74% | NA |
| All Indica | 2759 | 34.20% | 2.30% | 3.52% | 59.99% | NA |
| All Japonica | 1512 | 86.10% | 12.40% | 0.07% | 1.39% | NA |
| Aus | 269 | 48.70% | 0.00% | 6.32% | 44.98% | NA |
| Indica I | 595 | 20.00% | 0.00% | 3.70% | 76.30% | NA |
| Indica II | 465 | 49.70% | 10.80% | 1.72% | 37.85% | NA |
| Indica III | 913 | 33.00% | 0.20% | 4.49% | 62.32% | NA |
| Indica Intermediate | 786 | 37.20% | 1.50% | 3.31% | 58.02% | NA |
| Temperate Japonica | 767 | 93.40% | 6.30% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 91.30% | 5.60% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 52.30% | 46.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 29.20% | 14.60% | 0.00% | 56.25% | NA |
| Intermediate | 90 | 64.40% | 4.40% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114940313 | G -> A | LOC_Os01g26330.1 | upstream_gene_variant ; 4080.0bp to feature; MODIFIER | silent_mutation | Average:26.029; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0114940313 | G -> A | LOC_Os01g26340.1 | upstream_gene_variant ; 2033.0bp to feature; MODIFIER | silent_mutation | Average:26.029; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0114940313 | G -> A | LOC_Os01g26330-LOC_Os01g26340 | intergenic_region ; MODIFIER | silent_mutation | Average:26.029; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg0114940313 | G -> DEL | N | N | silent_mutation | Average:26.029; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114940313 | NA | 2.42E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114940313 | 9.69E-06 | 4.54E-07 | mr1719 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114940313 | 2.08E-06 | 1.20E-08 | mr1064_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114940313 | 4.16E-06 | 4.24E-07 | mr1695_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114940313 | NA | 6.22E-07 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |