Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114881487:

Variant ID: vg0114881487 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14881487
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CAATAACATTTTGATGGGTTTACTAATGTGTTTATGAAGGGGGAGATTGTGAAATCAAATTAGTGTTTTGATTATTCATTTATGATAGATAATTGGCATG[T/C]
GATCGATAATTGATTTTGATATTTGGTGATTATTGGTGAAGTGGTCCTCTCTACGTGGAGCCGGTCGGACCTCATAGGTAAGGCCGGTCGGACCAGTGTG

Reverse complement sequence

CACACTGGTCCGACCGGCCTTACCTATGAGGTCCGACCGGCTCCACGTAGAGAGGACCACTTCACCAATAATCACCAAATATCAAAATCAATTATCGATC[A/G]
CATGCCAATTATCTATCATAAATGAATAATCAAAACACTAATTTGATTTCACAATCTCCCCCTTCATAAACACATTAGTAAACCCATCAAAATGTTATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	35.30%	0.49%	15.70%	NA
All Indica	2759	74.70%	6.80%	0.80%	17.65%	NA
All Japonica	1512	0.50%	86.80%	0.00%	12.63%	NA
Aus	269	45.70%	33.50%	0.37%	20.45%	NA
Indica I	595	66.40%	15.50%	0.67%	17.48%	NA
Indica II	465	82.80%	4.90%	0.65%	11.61%	NA
Indica III	913	72.80%	2.00%	1.10%	24.10%	NA
Indica Intermediate	786	78.50%	7.00%	0.64%	13.87%	NA
Temperate Japonica	767	0.40%	94.10%	0.00%	5.48%	NA
Tropical Japonica	504	0.20%	91.50%	0.00%	8.33%	NA
Japonica Intermediate	241	1.70%	53.90%	0.00%	44.40%	NA
VI/Aromatic	96	59.40%	38.50%	0.00%	2.08%	NA
Intermediate	90	45.60%	46.70%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114881487	T -> DEL	N	N	silent_mutation	Average:29.454; most accessible tissue: Callus, score: 65.243	N	N	N	N
vg0114881487	T -> C	LOC_Os01g26240.1	upstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:29.454; most accessible tissue: Callus, score: 65.243	N	N	N	N
vg0114881487	T -> C	LOC_Os01g26250.1	upstream_gene_variant ; 348.0bp to feature; MODIFIER	silent_mutation	Average:29.454; most accessible tissue: Callus, score: 65.243	N	N	N	N
vg0114881487	T -> C	LOC_Os01g26240-LOC_Os01g26250	intergenic_region ; MODIFIER	silent_mutation	Average:29.454; most accessible tissue: Callus, score: 65.243	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114881487	NA	1.54E-06	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114881487	NA	6.83E-06	mr1719	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114881487	3.09E-06	3.09E-06	mr1891	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114881487	NA	6.16E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251