\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114831954:

Variant ID: vg0114831954 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14831954
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCGGAGGAGGTGCGCGTCAATGGCGGCGAAAGCGGCCTTCCCCCTCGCGGAGACCAGAGGAGGAGACACGCGACGACAACAGTGGCCCTCCCCCTTGC[C/T]
GAGGCTGGTGGAGGAGGCGCGTGACGGTTGTGTTAACCCATGCATATTCACACAGCCATGCTTAAATAAAATTTATTAGAAAAAAATATATATATACTAT

Reverse complement sequence

ATAGTATATATATATTTTTTTCTAATAAATTTTATTTAAGCATGGCTGTGTGAATATGCATGGGTTAACACAACCGTCACGCGCCTCCTCCACCAGCCTC[G/A]
GCAAGGGGGAGGGCCACTGTTGTCGTCGCGTGTCTCCTCCTCTGGTCTCCGCGAGGGGGAAGGCCGCTTTCGCCGCCATTGACGCGCACCTCCTCCGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 10.90% 1.50% 1.29% NA
All Indica  2759 98.00% 0.70% 0.25% 1.05% NA
All Japonica  1512 65.40% 30.60% 3.97% 0.00% NA
Aus  269 88.10% 0.40% 0.74% 10.78% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 98.30% 1.30% 0.22% 0.22% NA
Indica III  913 98.10% 0.30% 0.11% 1.42% NA
Indica Intermediate  786 96.70% 1.10% 0.25% 1.91% NA
Temperate Japonica  767 85.80% 9.30% 4.95% 0.00% NA
Tropical Japonica  504 29.00% 68.70% 2.38% 0.00% NA
Japonica Intermediate  241 76.80% 19.10% 4.15% 0.00% NA
VI/Aromatic  96 82.30% 15.60% 0.00% 2.08% NA
Intermediate  90 77.80% 18.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114831954 C -> T LOC_Os01g26174.1 downstream_gene_variant ; 3687.0bp to feature; MODIFIER silent_mutation Average:59.478; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0114831954 C -> T LOC_Os01g26174-LOC_Os01g26190 intergenic_region ; MODIFIER silent_mutation Average:59.478; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0114831954 C -> DEL N N silent_mutation Average:59.478; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114831954 C T 0.11 0.04 0.03 0.09 0.12 0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114831954 NA 2.18E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 7.65E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 8.03E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.42E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.78E-15 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.71E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 5.34E-06 1.38E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.04E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 3.72E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 2.18E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 5.29E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.25E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 7.28E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 7.31E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 4.16E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 5.17E-09 NA mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.12E-20 mr1334_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 4.99E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 9.40E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 1.54E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 2.72E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 2.15E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114831954 NA 6.14E-10 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251