\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114830962:

Variant ID: vg0114830962 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14830962
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAACTGTCTTTTTTATTTTTCTTACAATTTCGGAATTTATTATACTTTTTATTTTGAATTTTAATTAATCTCGTATTTGGTTCTTATGTGTACTATT[T/C]
TTCTAATATTGCTATTTTTAATTCTGAATTTTAGTTATTTTAAAATTGTATTTCTACTTGGACTCTCTTTTTTTCTCTCCGATTATAATGTGGGAATTTT

Reverse complement sequence

AAAATTCCCACATTATAATCGGAGAGAAAAAAAGAGAGTCCAAGTAGAAATACAATTTTAAAATAACTAAAATTCAGAATTAAAAATAGCAATATTAGAA[A/G]
AATAGTACACATAAGAACCAAATACGAGATTAATTAAAATTCAAAATAAAAAGTATAATAAATTCCGAAATTGTAAGAAAAATAAAAAAGACAGTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 43.80% 3.98% 6.31% NA
All Indica  2759 25.00% 62.80% 5.33% 6.78% NA
All Japonica  1512 86.20% 13.60% 0.07% 0.13% NA
Aus  269 30.50% 32.30% 6.69% 30.48% NA
Indica I  595 48.90% 45.20% 1.51% 4.37% NA
Indica II  465 34.20% 53.50% 9.46% 2.80% NA
Indica III  913 4.70% 80.60% 5.70% 8.98% NA
Indica Intermediate  786 25.20% 61.10% 5.34% 8.40% NA
Temperate Japonica  767 93.70% 6.10% 0.00% 0.13% NA
Tropical Japonica  504 89.90% 9.90% 0.00% 0.20% NA
Japonica Intermediate  241 54.40% 45.20% 0.41% 0.00% NA
VI/Aromatic  96 39.60% 16.70% 21.88% 21.88% NA
Intermediate  90 62.20% 30.00% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114830962 T -> DEL N N silent_mutation Average:26.393; most accessible tissue: Callus, score: 56.582 N N N N
vg0114830962 T -> C LOC_Os01g26174.1 downstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:26.393; most accessible tissue: Callus, score: 56.582 N N N N
vg0114830962 T -> C LOC_Os01g26174-LOC_Os01g26190 intergenic_region ; MODIFIER silent_mutation Average:26.393; most accessible tissue: Callus, score: 56.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114830962 NA 4.87E-07 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 4.27E-06 4.27E-06 mr1349 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 1.28E-06 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 3.66E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 4.20E-06 4.00E-07 mr1719 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 2.77E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 9.87E-06 mr1796 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 9.58E-08 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 2.61E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 3.85E-07 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 1.45E-07 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 3.77E-08 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114830962 NA 2.07E-07 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251