Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114684305:

Variant ID: vg0114684305 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14684305
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAACGAATGTAGAACTGGTGTGGCACATTCTAGTACAGCAAATCTGAACATATGTATGTTTAGATTCGTTTTACTAGGATGTGTCACATCCAATCCTAGG[T/C]
TAGTTTTTTATGGGACGAAGGGAGTATTTTTTTTTCTCTAGCACAATTAAAGATAATTGTCCATTACCCAATAGTCTCGTGATATGCTAAGTATGATTAC

Reverse complement sequence

GTAATCATACTTAGCATATCACGAGACTATTGGGTAATGGACAATTATCTTTAATTGTGCTAGAGAAAAAAAAATACTCCCTTCGTCCCATAAAAAACTA[A/G]
CCTAGGATTGGATGTGACACATCCTAGTAAAACGAATCTAAACATACATATGTTCAGATTTGCTGTACTAGAATGTGCCACACCAGTTCTACATTCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	0.50%	4.55%	4.21%	NA
All Indica	2759	84.50%	0.80%	7.72%	7.00%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	65.00%	2.70%	21.01%	11.26%	NA
Indica II	465	79.60%	0.40%	6.88%	13.12%	NA
Indica III	913	96.40%	0.00%	0.77%	2.85%	NA
Indica Intermediate	786	88.30%	0.50%	6.23%	4.96%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	0.00%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114684305	T -> DEL	N	N	silent_mutation	Average:21.697; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0114684305	T -> C	LOC_Os01g25880.1	upstream_gene_variant ; 870.0bp to feature; MODIFIER	silent_mutation	Average:21.697; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0114684305	T -> C	LOC_Os01g25880-LOC_Os01g25890	intergenic_region ; MODIFIER	silent_mutation	Average:21.697; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114684305	9.58E-08	NA	mr1519	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114684305	1.25E-08	3.87E-09	mr1519	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114684305	1.14E-07	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114684305	1.22E-07	7.70E-11	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251