Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114594007:

Variant ID: vg0114594007 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14594007
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, C: 0.20, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CATATGCAATCAGGAGATGCCAAGGTGCTTACATACAAGATCAGTATTACTAGCACTCCTACCAAATCGTATCTGTGCTTACATACAAAAATCAATTGGA[C/A]
GATCAGATGGACGGTTGCAGATGGATGGTGGGGTGCTCGGCGGCAGGTGGGGTGGCGGCGCTCGGTGGCGGGGTGGTGGCGCCCGGCGTCGGCGGTGCTC

Reverse complement sequence

GAGCACCGCCGACGCCGGGCGCCACCACCCCGCCACCGAGCGCCGCCACCCCACCTGCCGCCGAGCACCCCACCATCCATCTGCAACCGTCCATCTGATC[G/T]
TCCAATTGATTTTTGTATGTAAGCACAGATACGATTTGGTAGGAGTGCTAGTAATACTGATCTTGTATGTAAGCACCTTGGCATCTCCTGATTGCATATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	33.80%	0.95%	14.73%	NA
All Indica	2759	71.90%	1.70%	1.59%	24.86%	NA
All Japonica	1512	2.60%	97.20%	0.00%	0.13%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	50.80%	0.80%	2.02%	46.39%	NA
Indica II	465	74.60%	2.60%	1.51%	21.29%	NA
Indica III	913	81.40%	1.10%	1.31%	16.21%	NA
Indica Intermediate	786	75.20%	2.40%	1.65%	20.74%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	94.80%	0.00%	0.20%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	41.10%	48.90%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114594007	C -> A	LOC_Os01g25740.1	upstream_gene_variant ; 2253.0bp to feature; MODIFIER	silent_mutation	Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425	N	N	N	N
vg0114594007	C -> A	LOC_Os01g25760.1	downstream_gene_variant ; 3783.0bp to feature; MODIFIER	silent_mutation	Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425	N	N	N	N
vg0114594007	C -> A	LOC_Os01g25740-LOC_Os01g25760	intergenic_region ; MODIFIER	silent_mutation	Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425	N	N	N	N
vg0114594007	C -> DEL	N	N	silent_mutation	Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0114594007	C	A	-0.07	-0.04	-0.04	-0.05	-0.08	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114594007	NA	4.83E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	5.21E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	2.61E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	1.23E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	1.48E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	1.15E-26	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	2.79E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	6.98E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	3.12E-18	mr1162_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	2.97E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	9.85E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	9.00E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	3.43E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007	NA	5.96E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251