\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114594007:

Variant ID: vg0114594007 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14594007
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, C: 0.20, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CATATGCAATCAGGAGATGCCAAGGTGCTTACATACAAGATCAGTATTACTAGCACTCCTACCAAATCGTATCTGTGCTTACATACAAAAATCAATTGGA[C/A]
GATCAGATGGACGGTTGCAGATGGATGGTGGGGTGCTCGGCGGCAGGTGGGGTGGCGGCGCTCGGTGGCGGGGTGGTGGCGCCCGGCGTCGGCGGTGCTC

Reverse complement sequence

GAGCACCGCCGACGCCGGGCGCCACCACCCCGCCACCGAGCGCCGCCACCCCACCTGCCGCCGAGCACCCCACCATCCATCTGCAACCGTCCATCTGATC[G/T]
TCCAATTGATTTTTGTATGTAAGCACAGATACGATTTGGTAGGAGTGCTAGTAATACTGATCTTGTATGTAAGCACCTTGGCATCTCCTGATTGCATATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 33.80% 0.95% 14.73% NA
All Indica  2759 71.90% 1.70% 1.59% 24.86% NA
All Japonica  1512 2.60% 97.20% 0.00% 0.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 50.80% 0.80% 2.02% 46.39% NA
Indica II  465 74.60% 2.60% 1.51% 21.29% NA
Indica III  913 81.40% 1.10% 1.31% 16.21% NA
Indica Intermediate  786 75.20% 2.40% 1.65% 20.74% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 94.80% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 41.10% 48.90% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114594007 C -> A LOC_Os01g25740.1 upstream_gene_variant ; 2253.0bp to feature; MODIFIER silent_mutation Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0114594007 C -> A LOC_Os01g25760.1 downstream_gene_variant ; 3783.0bp to feature; MODIFIER silent_mutation Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0114594007 C -> A LOC_Os01g25740-LOC_Os01g25760 intergenic_region ; MODIFIER silent_mutation Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0114594007 C -> DEL N N silent_mutation Average:84.887; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114594007 C A -0.07 -0.04 -0.04 -0.05 -0.08 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114594007 NA 4.83E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 5.21E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 2.61E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 1.23E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 1.48E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 1.15E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 2.79E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 6.98E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 3.12E-18 mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 2.97E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 9.85E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 9.00E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 3.43E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114594007 NA 5.96E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251