Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114587154:

Variant ID: vg0114587154 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14587154
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, G: 0.37, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GATTAATGAATTTGTGGACTTAGAAATACCTAGCTCCTAAAAACCTTCGATAGTTGTGCCAAACAAGACTTTAGTAAGCTTTAAGAATGGGACACTCCCA[T/G]
TAAGCAAAACTGTGCAAAATTCATACAGCACGAGTGCAATTATCAATCGTACCATTATTGCGCTGCTGTCCTGTGAACTTCTCTTATGGGCAGCAATTCC

Reverse complement sequence

GGAATTGCTGCCCATAAGAGAAGTTCACAGGACAGCAGCGCAATAATGGTACGATTGATAATTGCACTCGTGCTGTATGAATTTTGCACAGTTTTGCTTA[A/C]
TGGGAGTGTCCCATTCTTAAAGCTTACTAAAGTCTTGTTTGGCACAACTATCGAAGGTTTTTAGGAGCTAGGTATTTCTAAGTCCACAAATTCATTAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 33.70% 0.55% 21.05% NA
All Indica  2759 61.80% 1.70% 0.94% 35.52% NA
All Japonica  1512 3.00% 96.90% 0.00% 0.13% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 47.70% 0.80% 1.01% 50.42% NA
Indica II  465 66.00% 3.20% 0.86% 29.89% NA
Indica III  913 68.20% 0.90% 0.77% 30.12% NA
Indica Intermediate  786 62.60% 2.40% 1.15% 33.84% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.70% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 36.70% 48.90% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114587154 T -> G LOC_Os01g25740.1 3_prime_UTR_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:62.493; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0114587154 T -> G LOC_Os01g25730.1 downstream_gene_variant ; 3776.0bp to feature; MODIFIER silent_mutation Average:62.493; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0114587154 T -> DEL N N silent_mutation Average:62.493; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114587154 T G 0.05 0.0 -0.02 0.04 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114587154 NA 5.55E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 2.70E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 1.22E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 3.06E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 4.54E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 3.21E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 4.32E-06 6.52E-07 mr1672 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 4.63E-06 1.80E-41 mr1072_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 6.85E-06 3.17E-41 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 2.18E-56 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 2.22E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 1.87E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 9.67E-06 1.06E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 2.53E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 1.15E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 6.52E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 1.54E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 1.77E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 6.90E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 2.85E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114587154 NA 4.75E-48 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251