Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114541969:

Variant ID: vg0114541969 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14541969
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTGCTTAGATGAAGATCAATCTAAAGTGGCTATGAGAGAGGTGCATGAAGGAATTTGTGGAACTCATCAATCGGCCCACAAGATGAATTGGTTGCTTAG[G/A]
AGAGCGGGGTTCTATTGGCTGAAGATGATTGATGATTGCTTCAAATATTATAGAGGATGCGAGGCTTGTCAATGGTTCGGCAATGTTCAATTGGCGCCCG

Reverse complement sequence

CGGGCGCCAATTGAACATTGCCGAACCATTGACAAGCCTCGCATCCTCTATAATATTTGAAGCAATCATCAATCATCTTCAGCCAATAGAACCCCGCTCT[C/T]
CTAAGCAACCAATTCATCTTGTGGGCCGATTGATGAGTTCCACAAATTCCTTCATGCACCTCTCTCATAGCCACTTTAGATTGATCTTCATCTAAGCACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	4.20%	27.19%	12.95%	NA
All Indica	2759	60.20%	5.90%	33.67%	0.18%	NA
All Japonica	1512	56.40%	0.30%	4.43%	38.82%	NA
Aus	269	15.20%	7.10%	77.70%	0.00%	NA
Indica I	595	55.50%	4.70%	39.83%	0.00%	NA
Indica II	465	69.50%	5.20%	24.95%	0.43%	NA
Indica III	913	59.10%	6.70%	34.17%	0.00%	NA
Indica Intermediate	786	59.50%	6.50%	33.59%	0.38%	NA
Temperate Japonica	767	84.50%	0.10%	1.17%	14.21%	NA
Tropical Japonica	504	20.20%	0.80%	8.53%	70.44%	NA
Japonica Intermediate	241	42.70%	0.00%	6.22%	51.04%	NA
VI/Aromatic	96	21.90%	7.30%	61.46%	9.38%	NA
Intermediate	90	61.10%	3.30%	23.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114541969	G -> A	LOC_Os01g25660.1	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:21.01; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0114541969	G -> A	LOC_Os01g25650.1	intron_variant ; MODIFIER	silent_mutation	Average:21.01; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0114541969	G -> DEL	N	N	silent_mutation	Average:21.01; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114541969	NA	3.30E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114541969	1.18E-06	NA	mr1498	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114541969	NA	8.29E-06	mr1960	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114541969	NA	2.15E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251