Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114538326:

Variant ID: vg0114538326 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14538326
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTCTGACCGCGGCCATGTTGCCGGTCTGACCGGGCCATAAGGCCGGTCTGATCGTCGACCCGATAGTGGTCCGACCGACGCCTCAGGCCGGTCTGACC[G/A]
TGTGCCACACATCGGTCTGACCGGCGCGTCTGGCCGGTCTGACCGGGCTCCAGCGCCGGTTTGATGAGAGGATTGTAAAGGGCGATGTGAGGGCTTCATC

Reverse complement sequence

GATGAAGCCCTCACATCGCCCTTTACAATCCTCTCATCAAACCGGCGCTGGAGCCCGGTCAGACCGGCCAGACGCGCCGGTCAGACCGATGTGTGGCACA[C/T]
GGTCAGACCGGCCTGAGGCGTCGGTCGGACCACTATCGGGTCGACGATCAGACCGGCCTTATGGCCCGGTCAGACCGGCAACATGGCCGCGGTCAGACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 0.10% 4.25% 18.62% NA
All Indica  2759 84.20% 0.30% 3.48% 12.11% NA
All Japonica  1512 63.80% 0.00% 4.43% 31.81% NA
Aus  269 81.40% 0.00% 3.35% 15.24% NA
Indica I  595 70.80% 0.20% 7.73% 21.34% NA
Indica II  465 85.20% 0.60% 2.15% 12.04% NA
Indica III  913 93.60% 0.20% 1.20% 4.93% NA
Indica Intermediate  786 82.70% 0.10% 3.69% 13.49% NA
Temperate Japonica  767 86.80% 0.00% 1.17% 11.99% NA
Tropical Japonica  504 33.10% 0.00% 7.74% 59.13% NA
Japonica Intermediate  241 54.40% 0.00% 7.88% 37.76% NA
VI/Aromatic  96 67.70% 0.00% 22.92% 9.38% NA
Intermediate  90 75.60% 0.00% 7.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114538326 G -> A LOC_Os01g25640.1 downstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:46.594; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg0114538326 G -> A LOC_Os01g25650.1 intron_variant ; MODIFIER silent_mutation Average:46.594; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg0114538326 G -> DEL N N silent_mutation Average:46.594; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114538326 G A -0.02 -0.02 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114538326 NA 2.94E-07 mr1654_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114538326 3.57E-06 1.08E-06 mr1654_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251