Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114524304:

Variant ID: vg0114524304 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14524304
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.25, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTGCTAGCTGGTTAGTGCTAAAGGGAGACACCATTCTTTCTAAAAAAAAAAGCTACTAGTACACTCAATATCTATGTATTTTTTTCTTCTTAGAGAAG[A/T]
TTCTCTTAAATTACTTATCCGATTTATAATCCGATTTCACCTTTGTGTTCGTAACAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTTATGA

Reverse complement sequence

TCATAAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTGTTACGAACACAAAGGTGAAATCGGATTATAAATCGGATAAGTAATTTAAGAGAA[T/A]
CTTCTCTAAGAAGAAAAAAATACATAGATATTGAGTGTACTAGTAGCTTTTTTTTTTAGAAAGAATGGTGTCTCCCTTTAGCACTAACCAGCTAGCACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.50%	15.40%	0.17%	4.89%	NA
All Indica	2759	68.00%	23.60%	0.25%	8.19%	NA
All Japonica	1512	97.50%	2.40%	0.00%	0.07%	NA
Aus	269	86.60%	11.90%	0.37%	1.12%	NA
Indica I	595	80.30%	14.50%	0.17%	5.04%	NA
Indica II	465	81.10%	13.50%	0.43%	4.95%	NA
Indica III	913	54.70%	36.40%	0.33%	8.65%	NA
Indica Intermediate	786	66.30%	21.60%	0.13%	11.96%	NA
Temperate Japonica	767	98.70%	1.20%	0.00%	0.13%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114524304	A -> T	LOC_Os01g25630.1	downstream_gene_variant ; 2298.0bp to feature; MODIFIER	silent_mutation	Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0114524304	A -> T	LOC_Os01g25610-LOC_Os01g25630	intergenic_region ; MODIFIER	silent_mutation	Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0114524304	A -> DEL	N	N	silent_mutation	Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114524304	NA	2.63E-07	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114524304	NA	4.67E-06	Grain_weight	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114524304	NA	4.49E-07	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	5.34E-06	6.50E-09	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	NA	1.08E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	3.55E-06	3.40E-09	mr1043	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	NA	6.93E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	NA	4.68E-06	mr1912	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	NA	2.25E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304	NA	2.83E-06	mr1269_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251