\
| Variant ID: vg0114524304 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14524304 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.25, others allele: 0.00, population size: 76. )
GAGTGCTAGCTGGTTAGTGCTAAAGGGAGACACCATTCTTTCTAAAAAAAAAAGCTACTAGTACACTCAATATCTATGTATTTTTTTCTTCTTAGAGAAG[A/T]
TTCTCTTAAATTACTTATCCGATTTATAATCCGATTTCACCTTTGTGTTCGTAACAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTTATGA
TCATAAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTGTTACGAACACAAAGGTGAAATCGGATTATAAATCGGATAAGTAATTTAAGAGAA[T/A]
CTTCTCTAAGAAGAAAAAAATACATAGATATTGAGTGTACTAGTAGCTTTTTTTTTTAGAAAGAATGGTGTCTCCCTTTAGCACTAACCAGCTAGCACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 15.40% | 0.17% | 4.89% | NA |
| All Indica | 2759 | 68.00% | 23.60% | 0.25% | 8.19% | NA |
| All Japonica | 1512 | 97.50% | 2.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 86.60% | 11.90% | 0.37% | 1.12% | NA |
| Indica I | 595 | 80.30% | 14.50% | 0.17% | 5.04% | NA |
| Indica II | 465 | 81.10% | 13.50% | 0.43% | 4.95% | NA |
| Indica III | 913 | 54.70% | 36.40% | 0.33% | 8.65% | NA |
| Indica Intermediate | 786 | 66.30% | 21.60% | 0.13% | 11.96% | NA |
| Temperate Japonica | 767 | 98.70% | 1.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114524304 | A -> T | LOC_Os01g25630.1 | downstream_gene_variant ; 2298.0bp to feature; MODIFIER | silent_mutation | Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0114524304 | A -> T | LOC_Os01g25610-LOC_Os01g25630 | intergenic_region ; MODIFIER | silent_mutation | Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0114524304 | A -> DEL | N | N | silent_mutation | Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114524304 | NA | 2.63E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114524304 | NA | 4.67E-06 | Grain_weight | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114524304 | NA | 4.49E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | 5.34E-06 | 6.50E-09 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | NA | 1.08E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | 3.55E-06 | 3.40E-09 | mr1043 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | NA | 6.93E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | NA | 4.68E-06 | mr1912 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | NA | 2.25E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114524304 | NA | 2.83E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |