\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114524304:

Variant ID: vg0114524304 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14524304
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.25, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTGCTAGCTGGTTAGTGCTAAAGGGAGACACCATTCTTTCTAAAAAAAAAAGCTACTAGTACACTCAATATCTATGTATTTTTTTCTTCTTAGAGAAG[A/T]
TTCTCTTAAATTACTTATCCGATTTATAATCCGATTTCACCTTTGTGTTCGTAACAATTAAATCTTTACAACAAGATCTCACATGATTATATTTTTATGA

Reverse complement sequence

TCATAAAAATATAATCATGTGAGATCTTGTTGTAAAGATTTAATTGTTACGAACACAAAGGTGAAATCGGATTATAAATCGGATAAGTAATTTAAGAGAA[T/A]
CTTCTCTAAGAAGAAAAAAATACATAGATATTGAGTGTACTAGTAGCTTTTTTTTTTAGAAAGAATGGTGTCTCCCTTTAGCACTAACCAGCTAGCACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 15.40% 0.17% 4.89% NA
All Indica  2759 68.00% 23.60% 0.25% 8.19% NA
All Japonica  1512 97.50% 2.40% 0.00% 0.07% NA
Aus  269 86.60% 11.90% 0.37% 1.12% NA
Indica I  595 80.30% 14.50% 0.17% 5.04% NA
Indica II  465 81.10% 13.50% 0.43% 4.95% NA
Indica III  913 54.70% 36.40% 0.33% 8.65% NA
Indica Intermediate  786 66.30% 21.60% 0.13% 11.96% NA
Temperate Japonica  767 98.70% 1.20% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114524304 A -> T LOC_Os01g25630.1 downstream_gene_variant ; 2298.0bp to feature; MODIFIER silent_mutation Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0114524304 A -> T LOC_Os01g25610-LOC_Os01g25630 intergenic_region ; MODIFIER silent_mutation Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0114524304 A -> DEL N N silent_mutation Average:41.209; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114524304 NA 2.63E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114524304 NA 4.67E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114524304 NA 4.49E-07 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 5.34E-06 6.50E-09 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 NA 1.08E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 3.55E-06 3.40E-09 mr1043 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 NA 6.93E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 NA 4.68E-06 mr1912 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 NA 2.25E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114524304 NA 2.83E-06 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251