Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114325124:

Variant ID: vg0114325124 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14325124
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATGTTGCTATTTTTTTAAAACTTATTCAAACATAAAAAGGTGATCGGAGTATATACAAAAGAAATAAATACAAAAGAAATAAAACTTCACAAAATTA[G/A]
CTAAACAAAAAGCAATTTGCCGGTGGGCTATCCTTACAAACAAGCTGGACCTTTTATTTCGGAGTCCAGATGAGTTAAATGAGAGGGTAACAATCAACGC

Reverse complement sequence

GCGTTGATTGTTACCCTCTCATTTAACTCATCTGGACTCCGAAATAAAAGGTCCAGCTTGTTTGTAAGGATAGCCCACCGGCAAATTGCTTTTTGTTTAG[C/T]
TAATTTTGTGAAGTTTTATTTCTTTTGTATTTATTTCTTTTGTATATACTCCGATCACCTTTTTATGTTTGAATAAGTTTTAAAAAAATAGCAACATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	18.00%	4.72%	43.10%	NA
All Indica	2759	1.50%	28.40%	6.05%	64.08%	NA
All Japonica	1512	97.20%	2.60%	0.00%	0.20%	NA
Aus	269	2.60%	2.60%	11.52%	83.27%	NA
Indica I	595	1.00%	12.40%	6.22%	80.34%	NA
Indica II	465	3.20%	45.80%	3.44%	47.53%	NA
Indica III	913	0.80%	29.60%	9.53%	60.13%	NA
Indica Intermediate	786	1.70%	28.80%	3.44%	66.16%	NA
Temperate Japonica	767	98.40%	1.40%	0.00%	0.13%	NA
Tropical Japonica	504	94.80%	5.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	7.30%	22.92%	16.67%	NA
Intermediate	90	48.90%	18.90%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114325124	G -> A	LOC_Os01g25360.1	upstream_gene_variant ; 1062.0bp to feature; MODIFIER	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N
vg0114325124	G -> A	LOC_Os01g25370.1	downstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N
vg0114325124	G -> A	LOC_Os01g25370.2	downstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N
vg0114325124	G -> A	LOC_Os01g25370.3	downstream_gene_variant ; 4916.0bp to feature; MODIFIER	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N
vg0114325124	G -> A	LOC_Os01g25340-LOC_Os01g25360	intergenic_region ; MODIFIER	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N
vg0114325124	G -> DEL	N	N	silent_mutation	Average:38.512; most accessible tissue: Callus, score: 54.917	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114325124	NA	3.13E-47	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	1.65E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	1.62E-08	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	1.16E-07	mr1748	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	1.59E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	2.84E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	5.70E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	1.36E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124	NA	6.87E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251