\
| Variant ID: vg0114317961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14317961 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 109. )
CGCGACAACAATCCTACATGCATGTAGTTACACACCTGAACAGGTGGTAGTAATTAACAAATAAATAAGCATAATTTGTACCAATGACAACATACACAAC[T/A]
GTAAAAGGAGAGTTTTTGTTGGTGACAACATAGCACCCATATATTAATACATATGGCCATATATAAAGTTGCACAAGCAATGAGATGAAACAAGCATAGT
ACTATGCTTGTTTCATCTCATTGCTTGTGCAACTTTATATATGGCCATATGTATTAATATATGGGTGCTATGTTGTCACCAACAAAAACTCTCCTTTTAC[A/T]
GTTGTGTATGTTGTCATTGGTACAAATTATGCTTATTTATTTGTTAATTACTACCACCTGTTCAGGTGTGTAACTACATGCATGTAGGATTGTTGTCGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 12.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 82.60% | 17.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 69.50% | 30.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.10% | 21.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 12.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114317961 | T -> A | LOC_Os01g25330.1 | downstream_gene_variant ; 1265.0bp to feature; MODIFIER | silent_mutation | Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 | N | N | N | N |
| vg0114317961 | T -> A | LOC_Os01g25340.1 | downstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 | N | N | N | N |
| vg0114317961 | T -> A | LOC_Os01g25330.3 | downstream_gene_variant ; 1270.0bp to feature; MODIFIER | silent_mutation | Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 | N | N | N | N |
| vg0114317961 | T -> A | LOC_Os01g25330.2 | downstream_gene_variant ; 1265.0bp to feature; MODIFIER | silent_mutation | Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 | N | N | N | N |
| vg0114317961 | T -> A | LOC_Os01g25330-LOC_Os01g25340 | intergenic_region ; MODIFIER | silent_mutation | Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114317961 | 1.60E-06 | 3.78E-10 | Awn_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114317961 | NA | 1.71E-08 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |