\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114317961:

Variant ID: vg0114317961 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14317961
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGACAACAATCCTACATGCATGTAGTTACACACCTGAACAGGTGGTAGTAATTAACAAATAAATAAGCATAATTTGTACCAATGACAACATACACAAC[T/A]
GTAAAAGGAGAGTTTTTGTTGGTGACAACATAGCACCCATATATTAATACATATGGCCATATATAAAGTTGCACAAGCAATGAGATGAAACAAGCATAGT

Reverse complement sequence

ACTATGCTTGTTTCATCTCATTGCTTGTGCAACTTTATATATGGCCATATGTATTAATATATGGGTGCTATGTTGTCACCAACAAAAACTCTCCTTTTAC[A/T]
GTTGTGTATGTTGTCATTGGTACAAATTATGCTTATTTATTTGTTAATTACTACCACCTGTTCAGGTGTGTAACTACATGCATGTAGGATTGTTGTCGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.10% 0.04% 0.00% NA
All Indica  2759 82.60% 17.30% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 76.00% 24.00% 0.00% 0.00% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 78.10% 21.80% 0.11% 0.00% NA
Indica Intermediate  786 87.80% 12.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114317961 T -> A LOC_Os01g25330.1 downstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0114317961 T -> A LOC_Os01g25340.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0114317961 T -> A LOC_Os01g25330.3 downstream_gene_variant ; 1270.0bp to feature; MODIFIER silent_mutation Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0114317961 T -> A LOC_Os01g25330.2 downstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0114317961 T -> A LOC_Os01g25330-LOC_Os01g25340 intergenic_region ; MODIFIER silent_mutation Average:65.214; most accessible tissue: Minghui63 flower, score: 77.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114317961 1.60E-06 3.78E-10 Awn_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114317961 NA 1.71E-08 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251