Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114284775:

Variant ID: vg0114284775 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14284775
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGAAAGATTTAAGCCGAAATTTTAATATATATGTCAAATGTGTATGTCCAATAATCATAGTCATCCAACTTATATAGAAAGGAATAAGTTCATCCAA[A/G]
GTCCCTTAACTTAACAACGAATATGATTTTCATCCTTCAACCGAAAAACCAGATACAACGGGTCCCTCAACTATCAAAACCAGTACAGATGAGATCCCTC

Reverse complement sequence

GAGGGATCTCATCTGTACTGGTTTTGATAGTTGAGGGACCCGTTGTATCTGGTTTTTCGGTTGAAGGATGAAAATCATATTCGTTGTTAAGTTAAGGGAC[T/C]
TTGGATGAACTTATTCCTTTCTATATAAGTTGGATGACTATGATTATTGGACATACACATTTGACATATATATTAAAATTTCGGCTTAAATCTTTCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	18.90%	1.33%	34.47%	NA
All Indica	2759	46.70%	0.70%	0.94%	51.65%	NA
All Japonica	1512	42.60%	55.30%	1.98%	0.13%	NA
Aus	269	33.50%	0.40%	2.23%	63.94%	NA
Indica I	595	41.30%	1.00%	1.68%	55.97%	NA
Indica II	465	25.80%	1.10%	1.08%	72.04%	NA
Indica III	913	62.30%	0.30%	0.55%	36.80%	NA
Indica Intermediate	786	44.90%	0.80%	0.76%	53.56%	NA
Temperate Japonica	767	23.30%	74.30%	2.35%	0.00%	NA
Tropical Japonica	504	60.90%	37.30%	1.59%	0.20%	NA
Japonica Intermediate	241	65.60%	32.40%	1.66%	0.41%	NA
VI/Aromatic	96	77.10%	20.80%	0.00%	2.08%	NA
Intermediate	90	47.80%	20.00%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114284775	A -> G	LOC_Os01g25290.1	upstream_gene_variant ; 1174.0bp to feature; MODIFIER	silent_mutation	Average:37.836; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N
vg0114284775	A -> G	LOC_Os01g25280.1	downstream_gene_variant ; 2588.0bp to feature; MODIFIER	silent_mutation	Average:37.836; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N
vg0114284775	A -> G	LOC_Os01g25280-LOC_Os01g25290	intergenic_region ; MODIFIER	silent_mutation	Average:37.836; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N
vg0114284775	A -> DEL	N	N	silent_mutation	Average:37.836; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114284775	NA	8.49E-06	mr1871	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114284775	NA	2.37E-07	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251