\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114251394:

Variant ID: vg0114251394 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14251394
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.22, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTACGGAGTAGCGTTTAGCAGTCCCTAAGTAAGCTGCTACATATGTTGAGAACCATGATAATCTCAGGTCTAAGGATTCAACACCAACACTAAATGAGAT[T/C,A]
ACTGATGACACAACACATATGACTCTTGCAGTGTCTCATGTTGAGTCTATCCAACAACATGTTCACCAACATGTGTCCACATTATTAATTTGGTATCTCT

Reverse complement sequence

AGAGATACCAAATTAATAATGTGGACACATGTTGGTGAACATGTTGTTGGATAGACTCAACATGAGACACTGCAAGAGTCATATGTGTTGTGTCATCAGT[A/G,T]
ATCTCATTTAGTGTTGGTGTTGAATCCTTAGACCTGAGATTATCATGGTTCTCAACATATGTAGCAGCTTACTTAGGGACTGCTAAACGCTACTCCGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 30.70% 2.86% 31.78% NA
All Indica  2759 2.20% 45.90% 3.41% 48.53% NA
All Japonica  1512 97.20% 2.60% 0.00% 0.13% NA
Aus  269 3.70% 32.70% 14.13% 49.44% NA
Indica I  595 1.50% 41.20% 3.36% 53.95% NA
Indica II  465 4.10% 23.40% 2.80% 69.68% NA
Indica III  913 0.90% 62.30% 3.40% 33.41% NA
Indica Intermediate  786 3.10% 43.60% 3.82% 49.49% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 44.80% 0.00% 2.08% NA
Intermediate  90 50.00% 17.80% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114251394 T -> A LOC_Os01g25240.1 upstream_gene_variant ; 1535.0bp to feature; MODIFIER N Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> A LOC_Os01g25220.1 downstream_gene_variant ; 3099.0bp to feature; MODIFIER N Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> A LOC_Os01g25230.1 intron_variant ; MODIFIER N Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> DEL N N silent_mutation Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> C LOC_Os01g25240.1 upstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> C LOC_Os01g25220.1 downstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0114251394 T -> C LOC_Os01g25230.1 intron_variant ; MODIFIER silent_mutation Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114251394 7.42E-06 8.94E-07 mr1208 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394 2.28E-06 1.54E-06 mr1316 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394 NA 6.63E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394 NA 1.21E-08 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251