Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114249827:

Variant ID: vg0114249827 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 14249827
Reference Allele: A	Alternative Allele: G,ACCGG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAATTGCTTATTTGGCCCCATTTTGAAGGCTAAGTACCAATTTGATCCTCTTTTTTTGAGTTTGCTTGTTTGACCCTGCTTTTCGAAAACGAACGATCG[A/G,ACCGG]
TCTGACCCTGTTCCGTTAAGGTGAGTTGACAGTGTTAAGTTAGGGGTGAATAGTCTATTTTGCGCTTGCTTATTTGACCATGTTATATATTGCTTATTTG

Reverse complement sequence

CAAATAAGCAATATATAACATGGTCAAATAAGCAAGCGCAAAATAGACTATTCACCCCTAACTTAACACTGTCAACTCACCTTAACGGAACAGGGTCAGA[T/C,CCGGT]
CGATCGTTCGTTTTCGAAAAGCAGGGTCAAACAAGCAAACTCAAAAAAAGAGGATCAAATTGGTACTTAGCCTTCAAAATGGGGCCAAATAAGCAATTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.10%	19.80%	2.03%	33.58%	ACCGG: 1.46%
All Indica	2759	44.30%	0.70%	1.16%	51.47%	ACCGG: 2.46%
All Japonica	1512	40.40%	58.00%	1.39%	0.13%	ACCGG: 0.07%
Aus	269	34.20%	0.00%	15.99%	49.81%	NA
Indica I	595	41.80%	0.50%	1.18%	56.47%	NA
Indica II	465	14.60%	1.30%	1.51%	71.61%	ACCGG: 10.97%
Indica III	913	62.10%	0.20%	0.55%	36.69%	ACCGG: 0.44%
Indica Intermediate	786	42.90%	0.90%	1.65%	52.93%	ACCGG: 1.65%
Temperate Japonica	767	22.40%	76.10%	1.43%	0.00%	NA
Tropical Japonica	504	56.70%	42.50%	0.60%	0.20%	NA
Japonica Intermediate	241	63.50%	32.80%	2.90%	0.41%	ACCGG: 0.41%
VI/Aromatic	96	77.10%	20.80%	0.00%	2.08%	NA
Intermediate	90	45.60%	22.20%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114249827	A -> G	LOC_Os01g25210.1	upstream_gene_variant ; 3715.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> G	LOC_Os01g25230.1	upstream_gene_variant ; 388.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> G	LOC_Os01g25240.1	upstream_gene_variant ; 3102.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> G	LOC_Os01g25220.1	downstream_gene_variant ; 1532.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> G	LOC_Os01g25220-LOC_Os01g25230	intergenic_region ; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> DEL	N	N	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> ACCGG	LOC_Os01g25210.1	upstream_gene_variant ; 3716.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> ACCGG	LOC_Os01g25230.1	upstream_gene_variant ; 387.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> ACCGG	LOC_Os01g25240.1	upstream_gene_variant ; 3101.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> ACCGG	LOC_Os01g25220.1	downstream_gene_variant ; 1533.0bp to feature; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N
vg0114249827	A -> ACCGG	LOC_Os01g25220-LOC_Os01g25230	intergenic_region ; MODIFIER	silent_mutation	Average:23.332; most accessible tissue: Callus, score: 41.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114249827	NA	1.14E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	9.28E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	2.65E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	4.65E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	5.78E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	1.65E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	1.73E-06	1.73E-06	mr1353	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	2.01E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	3.80E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	1.77E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827	NA	6.02E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251