\
| Variant ID: vg0114249827 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 14249827 |
| Reference Allele: A | Alternative Allele: G,ACCGG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAATTGCTTATTTGGCCCCATTTTGAAGGCTAAGTACCAATTTGATCCTCTTTTTTTGAGTTTGCTTGTTTGACCCTGCTTTTCGAAAACGAACGATCG[A/G,ACCGG]
TCTGACCCTGTTCCGTTAAGGTGAGTTGACAGTGTTAAGTTAGGGGTGAATAGTCTATTTTGCGCTTGCTTATTTGACCATGTTATATATTGCTTATTTG
CAAATAAGCAATATATAACATGGTCAAATAAGCAAGCGCAAAATAGACTATTCACCCCTAACTTAACACTGTCAACTCACCTTAACGGAACAGGGTCAGA[T/C,CCGGT]
CGATCGTTCGTTTTCGAAAAGCAGGGTCAAACAAGCAAACTCAAAAAAAGAGGATCAAATTGGTACTTAGCCTTCAAAATGGGGCCAAATAAGCAATTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.10% | 19.80% | 2.03% | 33.58% | ACCGG: 1.46% |
| All Indica | 2759 | 44.30% | 0.70% | 1.16% | 51.47% | ACCGG: 2.46% |
| All Japonica | 1512 | 40.40% | 58.00% | 1.39% | 0.13% | ACCGG: 0.07% |
| Aus | 269 | 34.20% | 0.00% | 15.99% | 49.81% | NA |
| Indica I | 595 | 41.80% | 0.50% | 1.18% | 56.47% | NA |
| Indica II | 465 | 14.60% | 1.30% | 1.51% | 71.61% | ACCGG: 10.97% |
| Indica III | 913 | 62.10% | 0.20% | 0.55% | 36.69% | ACCGG: 0.44% |
| Indica Intermediate | 786 | 42.90% | 0.90% | 1.65% | 52.93% | ACCGG: 1.65% |
| Temperate Japonica | 767 | 22.40% | 76.10% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 56.70% | 42.50% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 63.50% | 32.80% | 2.90% | 0.41% | ACCGG: 0.41% |
| VI/Aromatic | 96 | 77.10% | 20.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 45.60% | 22.20% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114249827 | A -> G | LOC_Os01g25210.1 | upstream_gene_variant ; 3715.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> G | LOC_Os01g25230.1 | upstream_gene_variant ; 388.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> G | LOC_Os01g25240.1 | upstream_gene_variant ; 3102.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> G | LOC_Os01g25220.1 | downstream_gene_variant ; 1532.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> G | LOC_Os01g25220-LOC_Os01g25230 | intergenic_region ; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> DEL | N | N | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> ACCGG | LOC_Os01g25210.1 | upstream_gene_variant ; 3716.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> ACCGG | LOC_Os01g25230.1 | upstream_gene_variant ; 387.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> ACCGG | LOC_Os01g25240.1 | upstream_gene_variant ; 3101.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> ACCGG | LOC_Os01g25220.1 | downstream_gene_variant ; 1533.0bp to feature; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| vg0114249827 | A -> ACCGG | LOC_Os01g25220-LOC_Os01g25230 | intergenic_region ; MODIFIER | silent_mutation | Average:23.332; most accessible tissue: Callus, score: 41.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114249827 | NA | 1.14E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 9.28E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 2.65E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 4.65E-06 | mr1208 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 5.78E-08 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 1.65E-06 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | 1.73E-06 | 1.73E-06 | mr1353 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 2.01E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 3.80E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 1.77E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114249827 | NA | 6.02E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |