\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114249827:

Variant ID: vg0114249827 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 14249827
Reference Allele: AAlternative Allele: G,ACCGG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAATTGCTTATTTGGCCCCATTTTGAAGGCTAAGTACCAATTTGATCCTCTTTTTTTGAGTTTGCTTGTTTGACCCTGCTTTTCGAAAACGAACGATCG[A/G,ACCGG]
TCTGACCCTGTTCCGTTAAGGTGAGTTGACAGTGTTAAGTTAGGGGTGAATAGTCTATTTTGCGCTTGCTTATTTGACCATGTTATATATTGCTTATTTG

Reverse complement sequence

CAAATAAGCAATATATAACATGGTCAAATAAGCAAGCGCAAAATAGACTATTCACCCCTAACTTAACACTGTCAACTCACCTTAACGGAACAGGGTCAGA[T/C,CCGGT]
CGATCGTTCGTTTTCGAAAAGCAGGGTCAAACAAGCAAACTCAAAAAAAGAGGATCAAATTGGTACTTAGCCTTCAAAATGGGGCCAAATAAGCAATTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.10% 19.80% 2.03% 33.58% ACCGG: 1.46%
All Indica  2759 44.30% 0.70% 1.16% 51.47% ACCGG: 2.46%
All Japonica  1512 40.40% 58.00% 1.39% 0.13% ACCGG: 0.07%
Aus  269 34.20% 0.00% 15.99% 49.81% NA
Indica I  595 41.80% 0.50% 1.18% 56.47% NA
Indica II  465 14.60% 1.30% 1.51% 71.61% ACCGG: 10.97%
Indica III  913 62.10% 0.20% 0.55% 36.69% ACCGG: 0.44%
Indica Intermediate  786 42.90% 0.90% 1.65% 52.93% ACCGG: 1.65%
Temperate Japonica  767 22.40% 76.10% 1.43% 0.00% NA
Tropical Japonica  504 56.70% 42.50% 0.60% 0.20% NA
Japonica Intermediate  241 63.50% 32.80% 2.90% 0.41% ACCGG: 0.41%
VI/Aromatic  96 77.10% 20.80% 0.00% 2.08% NA
Intermediate  90 45.60% 22.20% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114249827 A -> G LOC_Os01g25210.1 upstream_gene_variant ; 3715.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> G LOC_Os01g25230.1 upstream_gene_variant ; 388.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> G LOC_Os01g25240.1 upstream_gene_variant ; 3102.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> G LOC_Os01g25220.1 downstream_gene_variant ; 1532.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> G LOC_Os01g25220-LOC_Os01g25230 intergenic_region ; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> DEL N N silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> ACCGG LOC_Os01g25210.1 upstream_gene_variant ; 3716.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> ACCGG LOC_Os01g25230.1 upstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> ACCGG LOC_Os01g25240.1 upstream_gene_variant ; 3101.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> ACCGG LOC_Os01g25220.1 downstream_gene_variant ; 1533.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N
vg0114249827 A -> ACCGG LOC_Os01g25220-LOC_Os01g25230 intergenic_region ; MODIFIER silent_mutation Average:23.332; most accessible tissue: Callus, score: 41.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114249827 NA 1.14E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 9.28E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 2.65E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 4.65E-06 mr1208 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 5.78E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 1.65E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 1.73E-06 1.73E-06 mr1353 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 2.01E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 3.80E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 1.77E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114249827 NA 6.02E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251