\
| Variant ID: vg0114245822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14245822 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.24, others allele: 0.00, population size: 72. )
GGGCCACACATGGGCCGAGGTCCCAAACGAAGTTACAAGCCCATTGGCCCAATATAGGTGACGCAGCACCTTACTTCTGTGATTGCGGCCAAACGAAACG[A/G]
AACTCCGAGATGAGGCTAGATCCTTTGGAAAGAGGACTTTGAGAGCTTTCCATCAAGTACTCACGGGCCCAAAACGGAGCACGTATGTAGATTTGGCGGC
GCCGCCAAATCTACATACGTGCTCCGTTTTGGGCCCGTGAGTACTTGATGGAAAGCTCTCAAAGTCCTCTTTCCAAAGGATCTAGCCTCATCTCGGAGTT[T/C]
CGTTTCGTTTGGCCGCAATCACAGAAGTAAGGTGCTGCGTCACCTATATTGGGCCAATGGGCTTGTAACTTCGTTTGGGACCTCGGCCCATGTGTGGCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 30.80% | 0.78% | 33.01% | NA |
| All Indica | 2759 | 3.50% | 46.10% | 1.09% | 49.33% | NA |
| All Japonica | 1512 | 97.30% | 2.60% | 0.00% | 0.13% | NA |
| Aus | 269 | 2.60% | 32.30% | 1.49% | 63.57% | NA |
| Indica I | 595 | 4.20% | 41.50% | 1.34% | 52.94% | NA |
| Indica II | 465 | 5.40% | 23.40% | 1.72% | 69.46% | NA |
| Indica III | 913 | 1.10% | 62.30% | 0.55% | 36.04% | NA |
| Indica Intermediate | 786 | 4.60% | 44.10% | 1.15% | 50.13% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 44.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 52.20% | 17.80% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114245822 | A -> G | LOC_Os01g25210.1 | synonymous_variant ; p.Phe97Phe; LOW | synonymous_codon | Average:34.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0114245822 | A -> DEL | LOC_Os01g25210.1 | N | frameshift_variant | Average:34.229; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114245822 | NA | 1.79E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 5.63E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | 5.56E-06 | 1.86E-06 | mr1206 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 4.73E-06 | mr1289 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | 7.06E-06 | 5.24E-07 | mr1505 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 1.45E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 6.61E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 2.73E-07 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 8.12E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 7.67E-06 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | 8.55E-06 | 8.55E-06 | mr1736 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114245822 | NA | 3.83E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |