Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114223582:

Variant ID: vg0114223582 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14223582
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGATGAATTAATGTATGACGTGGCTCATCTTAGGTGACATCTCAATATTAACTTTTCACTATTGTAGATACCACAATTAGGCTATTACTTCTTATCGC[A/G]
GAGGTCTGAACCTGTCTAAATCCTTATCTCATAACCCATCCACTTTCTTTCTTGTGCGCTACCCCCTTTTCATATTGCCAAATTCTAGTTTCGACAGTTG

Reverse complement sequence

CAACTGTCGAAACTAGAATTTGGCAATATGAAAAGGGGGTAGCGCACAAGAAAGAAAGTGGATGGGTTATGAGATAAGGATTTAGACAGGTTCAGACCTC[T/C]
GCGATAAGAAGTAATAGCCTAATTGTGGTATCTACAATAGTGAAAAGTTAATATTGAGATGTCACCTAAGATGAGCCACGTCATACATTAATTCATCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	33.70%	0.17%	1.10%	NA
All Indica	2759	96.00%	1.90%	0.22%	1.88%	NA
All Japonica	1512	4.60%	95.40%	0.00%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	95.90%	3.70%	0.43%	0.00%	NA
Indica III	913	94.90%	0.40%	0.11%	4.60%	NA
Indica Intermediate	786	95.80%	2.50%	0.38%	1.27%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	10.50%	89.50%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114223582	A -> G	LOC_Os01g25170.1	upstream_gene_variant ; 2203.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25189.1	downstream_gene_variant ; 1314.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25189.4	downstream_gene_variant ; 1314.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25189.5	downstream_gene_variant ; 1314.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25189.2	downstream_gene_variant ; 1322.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25189.6	downstream_gene_variant ; 1833.0bp to feature; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> G	LOC_Os01g25170-LOC_Os01g25189	intergenic_region ; MODIFIER	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N
vg0114223582	A -> DEL	N	N	silent_mutation	Average:42.172; most accessible tissue: Zhenshan97 root, score: 64.819	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114223582	NA	2.14E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	2.83E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	1.72E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	3.56E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	3.18E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	1.47E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	1.33E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	2.45E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	1.13E-36	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	2.92E-45	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	5.44E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	2.58E-20	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	4.40E-16	mr1717_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	4.55E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	3.53E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223582	NA	6.23E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251