\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114223167:

Variant ID: vg0114223167 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14223167
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAATTATGTGAAACATTCTGGGCTGTATTCAAATGGGAGCTGAATCTAATAATTGAGGGTAATTTAGTCATTTGTGCTGAACACTAATTTGTGTGTG[A/G]
TTCCTTAAACGACACCTTTTCTCGGACGGAGGAAGTATTATTTGTTAAAAGATAAATTAATCTTATAGACATACATTTTGTACCAATACAAAATTTGAGT

Reverse complement sequence

ACTCAAATTTTGTATTGGTACAAAATGTATGTCTATAAGATTAATTTATCTTTTAACAAATAATACTTCCTCCGTCCGAGAAAAGGTGTCGTTTAAGGAA[T/C]
CACACACAAATTAGTGTTCAGCACAAATGACTAAATTACCCTCAATTATTAGATTCAGCTCCCATTTGAATACAGCCCAGAATGTTTCACATAATTACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.50% 29.90% 1.12% 34.45% NA
All Indica  2759 3.10% 43.60% 1.67% 51.65% NA
All Japonica  1512 95.40% 4.40% 0.00% 0.13% NA
Aus  269 2.20% 32.30% 1.12% 64.31% NA
Indica I  595 3.40% 41.70% 1.68% 53.28% NA
Indica II  465 6.70% 13.50% 1.72% 78.06% NA
Indica III  913 0.80% 62.00% 0.99% 36.25% NA
Indica Intermediate  786 3.40% 41.50% 2.42% 52.67% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 10.30% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 44.80% 0.00% 2.08% NA
Intermediate  90 52.20% 14.40% 4.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114223167 A -> G LOC_Os01g25170.1 upstream_gene_variant ; 1788.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25189.1 downstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25189.4 downstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25189.5 downstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25189.2 downstream_gene_variant ; 1737.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25189.6 downstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> G LOC_Os01g25170-LOC_Os01g25189 intergenic_region ; MODIFIER silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N
vg0114223167 A -> DEL N N silent_mutation Average:16.621; most accessible tissue: Callus, score: 41.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114223167 NA 1.03E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 4.49E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 4.17E-06 2.02E-06 mr1304 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 7.84E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 5.11E-07 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 7.25E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 2.86E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167 NA 6.02E-12 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251