\
| Variant ID: vg0114223167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14223167 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 101. )
TTGTAATTATGTGAAACATTCTGGGCTGTATTCAAATGGGAGCTGAATCTAATAATTGAGGGTAATTTAGTCATTTGTGCTGAACACTAATTTGTGTGTG[A/G]
TTCCTTAAACGACACCTTTTCTCGGACGGAGGAAGTATTATTTGTTAAAAGATAAATTAATCTTATAGACATACATTTTGTACCAATACAAAATTTGAGT
ACTCAAATTTTGTATTGGTACAAAATGTATGTCTATAAGATTAATTTATCTTTTAACAAATAATACTTCCTCCGTCCGAGAAAAGGTGTCGTTTAAGGAA[T/C]
CACACACAAATTAGTGTTCAGCACAAATGACTAAATTACCCTCAATTATTAGATTCAGCTCCCATTTGAATACAGCCCAGAATGTTTCACATAATTACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.50% | 29.90% | 1.12% | 34.45% | NA |
| All Indica | 2759 | 3.10% | 43.60% | 1.67% | 51.65% | NA |
| All Japonica | 1512 | 95.40% | 4.40% | 0.00% | 0.13% | NA |
| Aus | 269 | 2.20% | 32.30% | 1.12% | 64.31% | NA |
| Indica I | 595 | 3.40% | 41.70% | 1.68% | 53.28% | NA |
| Indica II | 465 | 6.70% | 13.50% | 1.72% | 78.06% | NA |
| Indica III | 913 | 0.80% | 62.00% | 0.99% | 36.25% | NA |
| Indica Intermediate | 786 | 3.40% | 41.50% | 2.42% | 52.67% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.30% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 44.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 52.20% | 14.40% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114223167 | A -> G | LOC_Os01g25170.1 | upstream_gene_variant ; 1788.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25189.1 | downstream_gene_variant ; 1729.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25189.4 | downstream_gene_variant ; 1729.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25189.5 | downstream_gene_variant ; 1729.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25189.2 | downstream_gene_variant ; 1737.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25189.6 | downstream_gene_variant ; 2248.0bp to feature; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> G | LOC_Os01g25170-LOC_Os01g25189 | intergenic_region ; MODIFIER | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| vg0114223167 | A -> DEL | N | N | silent_mutation | Average:16.621; most accessible tissue: Callus, score: 41.727 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114223167 | NA | 1.03E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 4.49E-09 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | 4.17E-06 | 2.02E-06 | mr1304 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 7.84E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 5.11E-07 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 7.25E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 2.86E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114223167 | NA | 6.02E-12 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |