\
| Variant ID: vg0114209645 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14209645 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, C: 0.26, others allele: 0.00, population size: 82. )
CAAATTTCCTACATATTAATGTGATATAGAAAGCCCATGAGAATGCATGGTTGCAGTGTGTTATACATCAATGTAAATATGGGTACCACACTTTAAATAT[G/C]
TGAATGGGTAAAGTCCTGGGGGACATATCCGGTGAAAATAAGCTGAGTGTTAGAAACTCGTGAAAATTATACCTAGAAGTTTTATAAATTCATGAAAAAA
TTTTTTCATGAATTTATAAAACTTCTAGGTATAATTTTCACGAGTTTCTAACACTCAGCTTATTTTCACCGGATATGTCCCCCAGGACTTTACCCATTCA[C/G]
ATATTTAAAGTGTGGTACCCATATTTACATTGATGTATAACACACTGCAACCATGCATTCTCATGGGCTTTCTATATCACATTAATATGTAGGAAATTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.10% | 33.00% | 0.34% | 32.59% | NA |
| All Indica | 2759 | 2.40% | 48.70% | 0.43% | 48.50% | NA |
| All Japonica | 1512 | 95.40% | 4.50% | 0.00% | 0.13% | NA |
| Aus | 269 | 1.50% | 33.10% | 1.49% | 63.94% | NA |
| Indica I | 595 | 2.70% | 41.80% | 0.84% | 54.62% | NA |
| Indica II | 465 | 4.10% | 24.90% | 0.43% | 70.54% | NA |
| Indica III | 913 | 0.50% | 67.30% | 0.22% | 31.98% | NA |
| Indica Intermediate | 786 | 3.30% | 46.30% | 0.38% | 50.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.30% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 54.20% | 44.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 52.20% | 17.80% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114209645 | G -> DEL | N | N | silent_mutation | Average:22.295; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0114209645 | G -> C | LOC_Os01g25160.1 | downstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:22.295; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0114209645 | G -> C | LOC_Os01g25150-LOC_Os01g25160 | intergenic_region ; MODIFIER | silent_mutation | Average:22.295; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114209645 | NA | 2.37E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 1.12E-07 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 1.09E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | 4.73E-06 | 1.85E-08 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 5.30E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 3.28E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | 1.14E-06 | 1.96E-06 | mr1229 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 1.14E-07 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 8.17E-06 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 3.44E-10 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 9.82E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 1.05E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 4.38E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 1.60E-07 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | 4.39E-06 | NA | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209645 | NA | 4.70E-12 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |