| Variant ID: vg0114209037 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14209037 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.22, others allele: 0.00, population size: 82. )
CAACCCGACAACGTATGTCGTGTCACATTGTCGGATTCGGCTTAATCGGCTAGCCTTGTCCAACTCGAACTCTGCCGATCCTGGTTGCAGCCGATTCGGA[T/C]
TTTAGCCGATCCTTACTCTGTTTTCGGAACGATTTCCATCTTGAATTCCACTTCAATCTGACCTTCATCTCCGATACTCAGATTACCAAATTTGGTTGTT
AACAACCAAATTTGGTAATCTGAGTATCGGAGATGAAGGTCAGATTGAAGTGGAATTCAAGATGGAAATCGTTCCGAAAACAGAGTAAGGATCGGCTAAA[A/G]
TCCGAATCGGCTGCAACCAGGATCGGCAGAGTTCGAGTTGGACAAGGCTAGCCGATTAAGCCGAATCCGACAATGTGACACGACATACGTTGTCGGGTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 31.80% | 0.74% | 31.95% | NA |
| All Indica | 2759 | 4.80% | 46.60% | 1.20% | 47.41% | NA |
| All Japonica | 1512 | 95.40% | 4.40% | 0.00% | 0.13% | NA |
| Aus | 269 | 2.60% | 33.10% | 0.74% | 63.57% | NA |
| Indica I | 595 | 3.70% | 42.00% | 1.51% | 52.77% | NA |
| Indica II | 465 | 4.90% | 24.90% | 2.37% | 67.74% | NA |
| Indica III | 913 | 5.30% | 62.40% | 0.22% | 32.09% | NA |
| Indica Intermediate | 786 | 5.00% | 44.50% | 1.40% | 49.11% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.30% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 44.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 52.20% | 17.80% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114209037 | T -> DEL | N | N | silent_mutation | Average:19.036; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| vg0114209037 | T -> C | LOC_Os01g25160.1 | downstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:19.036; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| vg0114209037 | T -> C | LOC_Os01g25150-LOC_Os01g25160 | intergenic_region ; MODIFIER | silent_mutation | Average:19.036; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114209037 | NA | 2.15E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209037 | NA | 6.05E-09 | mr1866 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209037 | NA | 3.13E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209037 | NA | 1.38E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209037 | NA | 5.58E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114209037 | NA | 2.63E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |