\
| Variant ID: vg0114152917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14152917 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, C: 0.33, others allele: 0.00, population size: 69. )
GATGCCGACGACGATGACGGCGCAGCGAGACGACGAGCCGGACGACCGACGGGACGTCGACGACGAGGACGAACGGTGACGACGACGACGGACCGCGGAG[G/C]
GGTTCGGATGGAGGGGAGGCGATGCCGAGGACGGCGTCGCCGGCTCGCCGCTGCGATGCCGGAGGTGGTGGCGACGTCGGCCGGCGCACAGGAGGAGACG
CGTCTCCTCCTGTGCGCCGGCCGACGTCGCCACCACCTCCGGCATCGCAGCGGCGAGCCGGCGACGCCGTCCTCGGCATCGCCTCCCCTCCATCCGAACC[C/G]
CTCCGCGGTCCGTCGTCGTCGTCACCGTTCGTCCTCGTCGTCGACGTCCCGTCGGTCGTCCGGCTCGTCGTCTCGCTGCGCCGTCATCGTCGTCGGCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 32.00% | 0.49% | 11.15% | NA |
| All Indica | 2759 | 33.50% | 47.00% | 0.80% | 18.70% | NA |
| All Japonica | 1512 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.70% | 39.50% | 0.34% | 0.50% | NA |
| Indica II | 465 | 35.10% | 23.40% | 0.43% | 41.08% | NA |
| Indica III | 913 | 11.00% | 66.90% | 0.77% | 21.36% | NA |
| Indica Intermediate | 786 | 38.90% | 43.50% | 1.40% | 16.16% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 46.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 13.30% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114152917 | G -> DEL | N | N | silent_mutation | Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| vg0114152917 | G -> C | LOC_Os01g25080.1 | upstream_gene_variant ; 56.0bp to feature; MODIFIER | silent_mutation | Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| vg0114152917 | G -> C | LOC_Os01g25070.1 | downstream_gene_variant ; 2650.0bp to feature; MODIFIER | silent_mutation | Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| vg0114152917 | G -> C | LOC_Os01g25070-LOC_Os01g25080 | intergenic_region ; MODIFIER | silent_mutation | Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114152917 | NA | 8.55E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 5.51E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 3.77E-10 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 3.05E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 2.32E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 4.15E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | 4.27E-08 | NA | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | 6.30E-08 | 1.03E-14 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114152917 | NA | 9.36E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |