Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114152917:

Variant ID: vg0114152917 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14152917
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, C: 0.33, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GATGCCGACGACGATGACGGCGCAGCGAGACGACGAGCCGGACGACCGACGGGACGTCGACGACGAGGACGAACGGTGACGACGACGACGGACCGCGGAG[G/C]
GGTTCGGATGGAGGGGAGGCGATGCCGAGGACGGCGTCGCCGGCTCGCCGCTGCGATGCCGGAGGTGGTGGCGACGTCGGCCGGCGCACAGGAGGAGACG

Reverse complement sequence

CGTCTCCTCCTGTGCGCCGGCCGACGTCGCCACCACCTCCGGCATCGCAGCGGCGAGCCGGCGACGCCGTCCTCGGCATCGCCTCCCCTCCATCCGAACC[C/G]
CTCCGCGGTCCGTCGTCGTCGTCACCGTTCGTCCTCGTCGTCGACGTCCCGTCGGTCGTCCGGCTCGTCGTCTCGCTGCGCCGTCATCGTCGTCGGCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	32.00%	0.49%	11.15%	NA
All Indica	2759	33.50%	47.00%	0.80%	18.70%	NA
All Japonica	1512	95.40%	4.60%	0.00%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	59.70%	39.50%	0.34%	0.50%	NA
Indica II	465	35.10%	23.40%	0.43%	41.08%	NA
Indica III	913	11.00%	66.90%	0.77%	21.36%	NA
Indica Intermediate	786	38.90%	43.50%	1.40%	16.16%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	89.70%	10.30%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	46.90%	0.00%	1.04%	NA
Intermediate	90	74.40%	13.30%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114152917	G -> DEL	N	N	silent_mutation	Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0114152917	G -> C	LOC_Os01g25080.1	upstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0114152917	G -> C	LOC_Os01g25070.1	downstream_gene_variant ; 2650.0bp to feature; MODIFIER	silent_mutation	Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N
vg0114152917	G -> C	LOC_Os01g25070-LOC_Os01g25080	intergenic_region ; MODIFIER	silent_mutation	Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114152917	NA	8.55E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	5.51E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	3.77E-10	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	3.05E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	2.32E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	4.15E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	4.27E-08	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	6.30E-08	1.03E-14	mr1519_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917	NA	9.36E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251