\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114152917:

Variant ID: vg0114152917 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14152917
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, C: 0.33, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GATGCCGACGACGATGACGGCGCAGCGAGACGACGAGCCGGACGACCGACGGGACGTCGACGACGAGGACGAACGGTGACGACGACGACGGACCGCGGAG[G/C]
GGTTCGGATGGAGGGGAGGCGATGCCGAGGACGGCGTCGCCGGCTCGCCGCTGCGATGCCGGAGGTGGTGGCGACGTCGGCCGGCGCACAGGAGGAGACG

Reverse complement sequence

CGTCTCCTCCTGTGCGCCGGCCGACGTCGCCACCACCTCCGGCATCGCAGCGGCGAGCCGGCGACGCCGTCCTCGGCATCGCCTCCCCTCCATCCGAACC[C/G]
CTCCGCGGTCCGTCGTCGTCGTCACCGTTCGTCCTCGTCGTCGACGTCCCGTCGGTCGTCCGGCTCGTCGTCTCGCTGCGCCGTCATCGTCGTCGGCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 32.00% 0.49% 11.15% NA
All Indica  2759 33.50% 47.00% 0.80% 18.70% NA
All Japonica  1512 95.40% 4.60% 0.00% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 59.70% 39.50% 0.34% 0.50% NA
Indica II  465 35.10% 23.40% 0.43% 41.08% NA
Indica III  913 11.00% 66.90% 0.77% 21.36% NA
Indica Intermediate  786 38.90% 43.50% 1.40% 16.16% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 89.70% 10.30% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 46.90% 0.00% 1.04% NA
Intermediate  90 74.40% 13.30% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114152917 G -> DEL N N silent_mutation Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0114152917 G -> C LOC_Os01g25080.1 upstream_gene_variant ; 56.0bp to feature; MODIFIER silent_mutation Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0114152917 G -> C LOC_Os01g25070.1 downstream_gene_variant ; 2650.0bp to feature; MODIFIER silent_mutation Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg0114152917 G -> C LOC_Os01g25070-LOC_Os01g25080 intergenic_region ; MODIFIER silent_mutation Average:34.017; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114152917 NA 8.55E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 5.51E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 3.77E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 3.05E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 2.32E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 4.15E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 4.27E-08 NA mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 6.30E-08 1.03E-14 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152917 NA 9.36E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251