Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114152314:

Variant ID: vg0114152314 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14152314
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGTATACAGAGATGGTCCATGGGTTGACGGAAGCGGACCCCGTGTGTCAACCGAGGCGAGTGGCCGACAAACGGACTCCACTGGACACCACGCGGGCT[A/G]
CACATGTGAAACCACGCGGCTACCGAGCGGGCACACAAACATGGTCACCACACACACAAGTGAACGACTACCGACACCGGTACACGGGTACCGGGGTCGA

Reverse complement sequence

TCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTCACTTGTGTGTGTGGTGACCATGTTTGTGTGCCCGCTCGGTAGCCGCGTGGTTTCACATGTG[T/C]
AGCCCGCGTGGTGTCCAGTGGAGTCCGTTTGTCGGCCACTCGCCTCGGTTGACACACGGGGTCCGCTTCCGTCAACCCATGGACCATCTCTGTATACTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.40%	34.00%	17.10%	14.56%	NA
All Indica	2759	50.20%	2.50%	24.65%	22.73%	NA
All Japonica	1512	4.60%	95.20%	0.13%	0.00%	NA
Aus	269	39.00%	1.50%	41.64%	17.84%	NA
Indica I	595	44.00%	1.50%	47.23%	7.23%	NA
Indica II	465	27.70%	6.00%	23.66%	42.58%	NA
Indica III	913	68.10%	1.10%	8.11%	22.67%	NA
Indica Intermediate	786	47.20%	2.70%	27.35%	22.77%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	10.30%	89.50%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	46.90%	51.00%	1.04%	1.04%	NA
Intermediate	90	22.20%	50.00%	14.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114152314	A -> G	LOC_Os01g25080.1	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:31.792; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0114152314	A -> G	LOC_Os01g25070.1	downstream_gene_variant ; 2047.0bp to feature; MODIFIER	silent_mutation	Average:31.792; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0114152314	A -> G	LOC_Os01g25070-LOC_Os01g25080	intergenic_region ; MODIFIER	silent_mutation	Average:31.792; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0114152314	A -> DEL	N	N	silent_mutation	Average:31.792; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114152314	4.69E-06	NA	mr1047_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	1.30E-06	NA	mr1047_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	NA	8.66E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	5.54E-06	NA	mr1471_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	3.21E-07	NA	mr1471_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	2.77E-06	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	NA	8.80E-10	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152314	6.09E-07	NA	mr1642_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251