\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114145813:

Variant ID: vg0114145813 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14145813
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGTGTATATAGTCCTTAGTTAATTTCCTGGTGAGGGTATTCCTCCGTATTTAGCCCCAGTTGTATGGTCATGATGGGCTGTCGTAAGGAACTCGGCA[A/G]
TAAGGGGTGGCTTCTCGAAGTACCAGGAGGGCATCGGATAGAGGGTATTAGCTAGTATGTCAGATAACTAGGATGTATGTATACTATGTATACTAGAAGT

Reverse complement sequence

ACTTCTAGTATACATAGTATACATACATCCTAGTTATCTGACATACTAGCTAATACCCTCTATCCGATGCCCTCCTGGTACTTCGAGAAGCCACCCCTTA[T/C]
TGCCGAGTTCCTTACGACAGCCCATCATGACCATACAACTGGGGCTAAATACGGAGGAATACCCTCACCAGGAAATTAACTAAGGACTATATACACGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 34.20% 9.23% 18.83% NA
All Indica  2759 56.60% 2.80% 15.15% 25.48% NA
All Japonica  1512 4.60% 95.20% 0.07% 0.07% NA
Aus  269 33.50% 0.70% 3.35% 62.45% NA
Indica I  595 58.80% 1.80% 32.61% 6.72% NA
Indica II  465 33.30% 6.70% 18.06% 41.94% NA
Indica III  913 70.20% 0.80% 1.86% 27.16% NA
Indica Intermediate  786 52.80% 3.60% 15.65% 27.99% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 10.30% 89.50% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 45.80% 52.10% 0.00% 2.08% NA
Intermediate  90 20.00% 53.30% 8.89% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114145813 A -> G LOC_Os01g25070.1 upstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:27.952; most accessible tissue: Callus, score: 61.66 N N N N
vg0114145813 A -> G LOC_Os01g25065-LOC_Os01g25070 intergenic_region ; MODIFIER silent_mutation Average:27.952; most accessible tissue: Callus, score: 61.66 N N N N
vg0114145813 A -> DEL N N silent_mutation Average:27.952; most accessible tissue: Callus, score: 61.66 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114145813 NA 2.33E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813 NA 2.70E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813 NA 5.85E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813 NA 3.64E-06 mr1904 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813 NA 3.37E-10 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251