Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114145813:

Variant ID: vg0114145813 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14145813
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GCGCGTGTATATAGTCCTTAGTTAATTTCCTGGTGAGGGTATTCCTCCGTATTTAGCCCCAGTTGTATGGTCATGATGGGCTGTCGTAAGGAACTCGGCA[A/G]
TAAGGGGTGGCTTCTCGAAGTACCAGGAGGGCATCGGATAGAGGGTATTAGCTAGTATGTCAGATAACTAGGATGTATGTATACTATGTATACTAGAAGT

Reverse complement sequence

ACTTCTAGTATACATAGTATACATACATCCTAGTTATCTGACATACTAGCTAATACCCTCTATCCGATGCCCTCCTGGTACTTCGAGAAGCCACCCCTTA[T/C]
TGCCGAGTTCCTTACGACAGCCCATCATGACCATACAACTGGGGCTAAATACGGAGGAATACCCTCACCAGGAAATTAACTAAGGACTATATACACGCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	34.20%	9.23%	18.83%	NA
All Indica	2759	56.60%	2.80%	15.15%	25.48%	NA
All Japonica	1512	4.60%	95.20%	0.07%	0.07%	NA
Aus	269	33.50%	0.70%	3.35%	62.45%	NA
Indica I	595	58.80%	1.80%	32.61%	6.72%	NA
Indica II	465	33.30%	6.70%	18.06%	41.94%	NA
Indica III	913	70.20%	0.80%	1.86%	27.16%	NA
Indica Intermediate	786	52.80%	3.60%	15.65%	27.99%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	10.30%	89.50%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	45.80%	52.10%	0.00%	2.08%	NA
Intermediate	90	20.00%	53.30%	8.89%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114145813	A -> G	LOC_Os01g25070.1	upstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:27.952; most accessible tissue: Callus, score: 61.66	N	N	N	N
vg0114145813	A -> G	LOC_Os01g25065-LOC_Os01g25070	intergenic_region ; MODIFIER	silent_mutation	Average:27.952; most accessible tissue: Callus, score: 61.66	N	N	N	N
vg0114145813	A -> DEL	N	N	silent_mutation	Average:27.952; most accessible tissue: Callus, score: 61.66	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114145813	NA	2.33E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813	NA	2.70E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813	NA	5.85E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813	NA	3.64E-06	mr1904	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114145813	NA	3.37E-10	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251