\
| Variant ID: vg0114137072 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14137072 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCACTAGCGGATCTCACGAATAGGTAAGGGAACATATATTTCTTTCTTCGCAGGTACGCGTATTGTTCATCTCTTTCCTTTTTTTCCGTTTCACTGTTT[T/C]
CGTTTTTTCCGTTTCCACTTTTAAGGTGATTAAGTTTCATTTTTTTTAGTTTCCTCTTTTACGTAACCCATAGTGTTTTTCTGTTTTTTTCACACCGTTT
AAACGGTGTGAAAAAAACAGAAAAACACTATGGGTTACGTAAAAGAGGAAACTAAAAAAAATGAAACTTAATCACCTTAAAAGTGGAAACGGAAAAAACG[A/G]
AAACAGTGAAACGGAAAAAAAGGAAAGAGATGAACAATACGCGTACCTGCGAAGAAAGAAATATATGTTCCCTTACCTATTCGTGAGATCCGCTAGTGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 10.70% | 3.00% | 50.06% | NA |
| All Indica | 2759 | 6.00% | 11.30% | 4.89% | 77.82% | NA |
| All Japonica | 1512 | 95.20% | 0.00% | 0.07% | 4.70% | NA |
| Aus | 269 | 3.30% | 68.00% | 1.49% | 27.14% | NA |
| Indica I | 595 | 2.20% | 11.60% | 3.53% | 82.69% | NA |
| Indica II | 465 | 18.30% | 6.70% | 4.09% | 70.97% | NA |
| Indica III | 913 | 2.10% | 8.00% | 5.70% | 84.23% | NA |
| Indica Intermediate | 786 | 6.10% | 17.70% | 5.47% | 70.74% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 0.00% | 10.52% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 52.10% | 1.00% | 1.04% | 45.83% | NA |
| Intermediate | 90 | 55.60% | 8.90% | 1.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114137072 | T -> DEL | N | N | silent_mutation | Average:40.882; most accessible tissue: Callus, score: 84.025 | N | N | N | N |
| vg0114137072 | T -> C | LOC_Os01g25060.1 | downstream_gene_variant ; 2584.0bp to feature; MODIFIER | silent_mutation | Average:40.882; most accessible tissue: Callus, score: 84.025 | N | N | N | N |
| vg0114137072 | T -> C | LOC_Os01g25065.1 | downstream_gene_variant ; 526.0bp to feature; MODIFIER | silent_mutation | Average:40.882; most accessible tissue: Callus, score: 84.025 | N | N | N | N |
| vg0114137072 | T -> C | LOC_Os01g25060-LOC_Os01g25065 | intergenic_region ; MODIFIER | silent_mutation | Average:40.882; most accessible tissue: Callus, score: 84.025 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114137072 | NA | 5.00E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 5.42E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 3.99E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 6.70E-07 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 6.02E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 4.86E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | 3.60E-06 | NA | mr1528 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 4.41E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114137072 | NA | 3.32E-07 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |