\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114137072:

Variant ID: vg0114137072 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14137072
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCACTAGCGGATCTCACGAATAGGTAAGGGAACATATATTTCTTTCTTCGCAGGTACGCGTATTGTTCATCTCTTTCCTTTTTTTCCGTTTCACTGTTT[T/C]
CGTTTTTTCCGTTTCCACTTTTAAGGTGATTAAGTTTCATTTTTTTTAGTTTCCTCTTTTACGTAACCCATAGTGTTTTTCTGTTTTTTTCACACCGTTT

Reverse complement sequence

AAACGGTGTGAAAAAAACAGAAAAACACTATGGGTTACGTAAAAGAGGAAACTAAAAAAAATGAAACTTAATCACCTTAAAAGTGGAAACGGAAAAAACG[A/G]
AAACAGTGAAACGGAAAAAAAGGAAAGAGATGAACAATACGCGTACCTGCGAAGAAAGAAATATATGTTCCCTTACCTATTCGTGAGATCCGCTAGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 10.70% 3.00% 50.06% NA
All Indica  2759 6.00% 11.30% 4.89% 77.82% NA
All Japonica  1512 95.20% 0.00% 0.07% 4.70% NA
Aus  269 3.30% 68.00% 1.49% 27.14% NA
Indica I  595 2.20% 11.60% 3.53% 82.69% NA
Indica II  465 18.30% 6.70% 4.09% 70.97% NA
Indica III  913 2.10% 8.00% 5.70% 84.23% NA
Indica Intermediate  786 6.10% 17.70% 5.47% 70.74% NA
Temperate Japonica  767 98.20% 0.00% 0.00% 1.83% NA
Tropical Japonica  504 89.50% 0.00% 0.00% 10.52% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 52.10% 1.00% 1.04% 45.83% NA
Intermediate  90 55.60% 8.90% 1.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114137072 T -> DEL N N silent_mutation Average:40.882; most accessible tissue: Callus, score: 84.025 N N N N
vg0114137072 T -> C LOC_Os01g25060.1 downstream_gene_variant ; 2584.0bp to feature; MODIFIER silent_mutation Average:40.882; most accessible tissue: Callus, score: 84.025 N N N N
vg0114137072 T -> C LOC_Os01g25065.1 downstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:40.882; most accessible tissue: Callus, score: 84.025 N N N N
vg0114137072 T -> C LOC_Os01g25060-LOC_Os01g25065 intergenic_region ; MODIFIER silent_mutation Average:40.882; most accessible tissue: Callus, score: 84.025 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114137072 NA 5.00E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 5.42E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 3.99E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 6.70E-07 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 6.02E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 4.86E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 3.60E-06 NA mr1528 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 4.41E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072 NA 3.32E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251