Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114135723:

Variant ID: vg0114135723 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14135723
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CACCATCAGCAGCCCACCTCTACTATCCCGCAGCATTTATGCCCAGATAATGACACTTAATAATCTAAGCACCACGCTTGCATTACTAAATACTACTCAA[C/T]
ATCCATGCATCCAACATAGAGCAACCGAACACTCGGACATTAAACCTACACCAATGCACCTCTCTTGTAAGCTAGCTACAAGAGGATAGGTGAATGATTG

Reverse complement sequence

CAATCATTCACCTATCCTCTTGTAGCTAGCTTACAAGAGAGGTGCATTGGTGTAGGTTTAATGTCCGAGTGTTCGGTTGCTCTATGTTGGATGCATGGAT[G/A]
TTGAGTAGTATTTAGTAATGCAAGCGTGGTGCTTAGATTATTAAGTGTCATTATCTGGGCATAAATGCTGCGGGATAGTAGAGGTGGGCTGCTGATGGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	21.40%	1.06%	41.16%	NA
All Indica	2759	6.10%	29.50%	1.67%	62.74%	NA
All Japonica	1512	95.20%	0.10%	0.00%	4.63%	NA
Aus	269	3.70%	66.20%	1.49%	28.62%	NA
Indica I	595	2.70%	57.80%	1.34%	38.15%	NA
Indica II	465	18.30%	28.60%	1.94%	51.18%	NA
Indica III	913	1.40%	7.30%	1.20%	90.03%	NA
Indica Intermediate	786	7.00%	34.20%	2.29%	56.49%	NA
Temperate Japonica	767	98.20%	0.00%	0.00%	1.83%	NA
Tropical Japonica	504	89.50%	0.20%	0.00%	10.32%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	52.10%	1.00%	0.00%	46.88%	NA
Intermediate	90	54.40%	21.10%	0.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114135723	C -> T	LOC_Os01g25060.1	downstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:11.349; most accessible tissue: Callus, score: 74.377	N	N	N	N
vg0114135723	C -> T	LOC_Os01g25065.1	downstream_gene_variant ; 1875.0bp to feature; MODIFIER	silent_mutation	Average:11.349; most accessible tissue: Callus, score: 74.377	N	N	N	N
vg0114135723	C -> T	LOC_Os01g25060-LOC_Os01g25065	intergenic_region ; MODIFIER	silent_mutation	Average:11.349; most accessible tissue: Callus, score: 74.377	N	N	N	N
vg0114135723	C -> DEL	N	N	silent_mutation	Average:11.349; most accessible tissue: Callus, score: 74.377	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114135723	NA	2.57E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	9.70E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	2.93E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	2.28E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	4.81E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	5.63E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	3.87E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	1.14E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	5.26E-08	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	3.97E-06	1.96E-07	mr1208	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	1.31E-07	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	7.03E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	5.50E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	6.27E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723	NA	1.81E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251