\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114135723:

Variant ID: vg0114135723 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14135723
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CACCATCAGCAGCCCACCTCTACTATCCCGCAGCATTTATGCCCAGATAATGACACTTAATAATCTAAGCACCACGCTTGCATTACTAAATACTACTCAA[C/T]
ATCCATGCATCCAACATAGAGCAACCGAACACTCGGACATTAAACCTACACCAATGCACCTCTCTTGTAAGCTAGCTACAAGAGGATAGGTGAATGATTG

Reverse complement sequence

CAATCATTCACCTATCCTCTTGTAGCTAGCTTACAAGAGAGGTGCATTGGTGTAGGTTTAATGTCCGAGTGTTCGGTTGCTCTATGTTGGATGCATGGAT[G/A]
TTGAGTAGTATTTAGTAATGCAAGCGTGGTGCTTAGATTATTAAGTGTCATTATCTGGGCATAAATGCTGCGGGATAGTAGAGGTGGGCTGCTGATGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 21.40% 1.06% 41.16% NA
All Indica  2759 6.10% 29.50% 1.67% 62.74% NA
All Japonica  1512 95.20% 0.10% 0.00% 4.63% NA
Aus  269 3.70% 66.20% 1.49% 28.62% NA
Indica I  595 2.70% 57.80% 1.34% 38.15% NA
Indica II  465 18.30% 28.60% 1.94% 51.18% NA
Indica III  913 1.40% 7.30% 1.20% 90.03% NA
Indica Intermediate  786 7.00% 34.20% 2.29% 56.49% NA
Temperate Japonica  767 98.20% 0.00% 0.00% 1.83% NA
Tropical Japonica  504 89.50% 0.20% 0.00% 10.32% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 52.10% 1.00% 0.00% 46.88% NA
Intermediate  90 54.40% 21.10% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114135723 C -> T LOC_Os01g25060.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:11.349; most accessible tissue: Callus, score: 74.377 N N N N
vg0114135723 C -> T LOC_Os01g25065.1 downstream_gene_variant ; 1875.0bp to feature; MODIFIER silent_mutation Average:11.349; most accessible tissue: Callus, score: 74.377 N N N N
vg0114135723 C -> T LOC_Os01g25060-LOC_Os01g25065 intergenic_region ; MODIFIER silent_mutation Average:11.349; most accessible tissue: Callus, score: 74.377 N N N N
vg0114135723 C -> DEL N N silent_mutation Average:11.349; most accessible tissue: Callus, score: 74.377 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114135723 NA 2.57E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 9.70E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 2.93E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 2.28E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 4.81E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 5.63E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 3.87E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 1.14E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 5.26E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 3.97E-06 1.96E-07 mr1208 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 1.31E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 7.03E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 5.50E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 6.27E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114135723 NA 1.81E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251