\
| Variant ID: vg0114124547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14124547 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.03, others allele: 0.00, population size: 182. )
TATAATTGAAGACATGTCTTAGGGAAACATCCCGGAATACGGTGGCTCAGGTATAGAGAATGAAGGTATTGATTTTGATCTGGAAGATATGTTGCGGCAC[T/G]
TTGAACCAGAGGTCCTAACTGGTACAAGACGAGGGTTGGACAATTGGGAAGCGTTGGAAAAAGCAGCGAAGGAGCTTCTGTACGACGAAGCCAAAGGATG
CATCCTTTGGCTTCGTCGTACAGAAGCTCCTTCGCTGCTTTTTCCAACGCTTCCCAATTGTCCAACCCTCGTCTTGTACCAGTTAGGACCTCTGGTTCAA[A/C]
GTGCCGCAACATATCTTCCAGATCAAAATCAATACCTTCATTCTCTATACCTGAGCCACCGTATTCCGGGATGTTTCCCTAAGACATGTCTTCAATTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 45.20% | 6.86% | 0.06% | NA |
| All Indica | 2759 | 25.40% | 66.30% | 8.23% | 0.07% | NA |
| All Japonica | 1512 | 95.40% | 0.90% | 3.70% | 0.07% | NA |
| Aus | 269 | 3.00% | 89.20% | 7.81% | 0.00% | NA |
| Indica I | 595 | 3.70% | 86.90% | 9.24% | 0.17% | NA |
| Indica II | 465 | 58.70% | 35.70% | 5.38% | 0.22% | NA |
| Indica III | 913 | 23.70% | 69.10% | 7.23% | 0.00% | NA |
| Indica Intermediate | 786 | 24.00% | 65.60% | 10.31% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 1.56% | 0.13% | NA |
| Tropical Japonica | 504 | 89.70% | 2.00% | 8.33% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 30.20% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 28.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114124547 | T -> G | LOC_Os01g25040.1 | missense_variant ; p.Phe308Val; MODERATE | nonsynonymous_codon ; F308V | Average:32.236; most accessible tissue: Minghui63 flag leaf, score: 58.568 | unknown | unknown | TOLERATED | 1.00 |
| vg0114124547 | T -> DEL | LOC_Os01g25040.1 | N | frameshift_variant | Average:32.236; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114124547 | NA | 1.42E-11 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114124547 | NA | 5.65E-11 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114124547 | NA | 1.51E-11 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 5.63E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 1.56E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 9.02E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 1.39E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 3.39E-11 | mr1654_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 3.70E-07 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114124547 | NA | 1.23E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |