Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114119286:

Variant ID: vg0114119286 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14119286
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, C: 0.47, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TACTCGTTTTTTATTAATATAACTAGAAAGATAGTCCAAGCAAATGCATGGGCATCTATCGTAAGTTGTATATGAGATACTTATAGAAGCATAATATTAA[G/C]
TGGGTAACATCTGCATGCCATGCTTCAAAAGAACAATTTGTTTCATAAATTTTCTTTTTGTCATTGCTTAGATAATTTTTCTATCCTATTAGAGTTGTTC

Reverse complement sequence

GAACAACTCTAATAGGATAGAAAAATTATCTAAGCAATGACAAAAAGAAAATTTATGAAACAAATTGTTCTTTTGAAGCATGGCATGCAGATGTTACCCA[C/G]
TTAATATTATGCTTCTATAAGTATCTCATATACAACTTACGATAGATGCCCATGCATTTGCTTGGACTATCTTTCTAGTTATATTAATAAAAAACGAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.70%	14.80%	1.46%	50.04%	NA
All Indica	2759	2.00%	24.50%	1.99%	71.51%	NA
All Japonica	1512	95.20%	0.10%	0.07%	4.63%	NA
Aus	269	1.10%	1.90%	2.97%	94.05%	NA
Indica I	595	1.80%	0.50%	3.03%	94.62%	NA
Indica II	465	3.20%	57.20%	0.86%	38.71%	NA
Indica III	913	0.70%	24.90%	1.10%	73.38%	NA
Indica Intermediate	786	2.90%	22.90%	2.93%	71.25%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	89.50%	0.00%	0.20%	10.32%	NA
Japonica Intermediate	241	97.50%	0.40%	0.00%	2.07%	NA
VI/Aromatic	96	51.00%	1.00%	0.00%	47.92%	NA
Intermediate	90	51.10%	17.80%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114119286	G -> DEL	N	N	silent_mutation	Average:28.566; most accessible tissue: Callus, score: 77.553	N	N	N	N
vg0114119286	G -> C	LOC_Os01g25030.1	upstream_gene_variant ; 1397.0bp to feature; MODIFIER	silent_mutation	Average:28.566; most accessible tissue: Callus, score: 77.553	N	N	N	N
vg0114119286	G -> C	LOC_Os01g25040.1	upstream_gene_variant ; 2829.0bp to feature; MODIFIER	silent_mutation	Average:28.566; most accessible tissue: Callus, score: 77.553	N	N	N	N
vg0114119286	G -> C	LOC_Os01g25020.1	downstream_gene_variant ; 4993.0bp to feature; MODIFIER	silent_mutation	Average:28.566; most accessible tissue: Callus, score: 77.553	N	N	N	N
vg0114119286	G -> C	LOC_Os01g25030-LOC_Os01g25040	intergenic_region ; MODIFIER	silent_mutation	Average:28.566; most accessible tissue: Callus, score: 77.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114119286	NA	1.94E-10	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114119286	NA	7.05E-13	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114119286	NA	6.18E-13	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	3.99E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	8.36E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	3.27E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	6.99E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	2.95E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	6.93E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	9.58E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	4.29E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	2.20E-07	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	1.86E-06	mr1362_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	4.08E-07	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	1.94E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	1.15E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	7.81E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	2.42E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	1.24E-17	mr1565_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	2.72E-13	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	3.39E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	2.71E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286	NA	3.53E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251