\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114119286:

Variant ID: vg0114119286 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14119286
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, C: 0.47, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCGTTTTTTATTAATATAACTAGAAAGATAGTCCAAGCAAATGCATGGGCATCTATCGTAAGTTGTATATGAGATACTTATAGAAGCATAATATTAA[G/C]
TGGGTAACATCTGCATGCCATGCTTCAAAAGAACAATTTGTTTCATAAATTTTCTTTTTGTCATTGCTTAGATAATTTTTCTATCCTATTAGAGTTGTTC

Reverse complement sequence

GAACAACTCTAATAGGATAGAAAAATTATCTAAGCAATGACAAAAAGAAAATTTATGAAACAAATTGTTCTTTTGAAGCATGGCATGCAGATGTTACCCA[C/G]
TTAATATTATGCTTCTATAAGTATCTCATATACAACTTACGATAGATGCCCATGCATTTGCTTGGACTATCTTTCTAGTTATATTAATAAAAAACGAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 14.80% 1.46% 50.04% NA
All Indica  2759 2.00% 24.50% 1.99% 71.51% NA
All Japonica  1512 95.20% 0.10% 0.07% 4.63% NA
Aus  269 1.10% 1.90% 2.97% 94.05% NA
Indica I  595 1.80% 0.50% 3.03% 94.62% NA
Indica II  465 3.20% 57.20% 0.86% 38.71% NA
Indica III  913 0.70% 24.90% 1.10% 73.38% NA
Indica Intermediate  786 2.90% 22.90% 2.93% 71.25% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 89.50% 0.00% 0.20% 10.32% NA
Japonica Intermediate  241 97.50% 0.40% 0.00% 2.07% NA
VI/Aromatic  96 51.00% 1.00% 0.00% 47.92% NA
Intermediate  90 51.10% 17.80% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114119286 G -> DEL N N silent_mutation Average:28.566; most accessible tissue: Callus, score: 77.553 N N N N
vg0114119286 G -> C LOC_Os01g25030.1 upstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:28.566; most accessible tissue: Callus, score: 77.553 N N N N
vg0114119286 G -> C LOC_Os01g25040.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:28.566; most accessible tissue: Callus, score: 77.553 N N N N
vg0114119286 G -> C LOC_Os01g25020.1 downstream_gene_variant ; 4993.0bp to feature; MODIFIER silent_mutation Average:28.566; most accessible tissue: Callus, score: 77.553 N N N N
vg0114119286 G -> C LOC_Os01g25030-LOC_Os01g25040 intergenic_region ; MODIFIER silent_mutation Average:28.566; most accessible tissue: Callus, score: 77.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114119286 NA 1.94E-10 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114119286 NA 7.05E-13 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0114119286 NA 6.18E-13 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 3.99E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 8.36E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 3.27E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 6.99E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 2.95E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 6.93E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 9.58E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 4.29E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 2.20E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 1.86E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 4.08E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 1.94E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 1.15E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 7.81E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 2.42E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 1.24E-17 mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 2.72E-13 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 3.39E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 2.71E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114119286 NA 3.53E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251