\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114089932:

Variant ID: vg0114089932 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14089932
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGTGTTTTCACCTATACGGTTGGCGGACTCCGCCGCCGTTGATGGGCCTCATCATCTACACCACCGGCTTGGTTCCACTGGTGCCGACTGGTGTTTTC[A/G]
TCGCCATTGATGGACGACTTTGTTCCCACATTGGTCACCTCTGCCATCATCAAGGGGAATATTACAAAGCTAAGTCATCATTAATTTTCTTTTTTATATG

Reverse complement sequence

CATATAAAAAAGAAAATTAATGATGACTTAGCTTTGTAATATTCCCCTTGATGATGGCAGAGGTGACCAATGTGGGAACAAAGTCGTCCATCAATGGCGA[T/C]
GAAAACACCAGTCGGCACCAGTGGAACCAAGCCGGTGGTGTAGATGATGAGGCCCATCAACGGCGGCGGAGTCCGCCAACCGTATAGGTGAAAACACTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 11.20% 3.58% 19.13% NA
All Indica  2759 71.50% 1.20% 0.98% 26.28% NA
All Japonica  1512 59.40% 32.10% 8.33% 0.13% NA
Aus  269 35.30% 0.70% 2.60% 61.34% NA
Indica I  595 43.20% 1.00% 0.84% 54.96% NA
Indica II  465 71.60% 1.90% 1.08% 25.38% NA
Indica III  913 93.40% 0.40% 0.22% 5.91% NA
Indica Intermediate  786 67.60% 1.80% 1.91% 28.75% NA
Temperate Japonica  767 28.70% 58.30% 13.04% 0.00% NA
Tropical Japonica  504 95.20% 1.80% 2.78% 0.20% NA
Japonica Intermediate  241 82.20% 12.40% 4.98% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 68.90% 10.00% 8.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114089932 A -> G LOC_Os01g24990.1 downstream_gene_variant ; 2897.0bp to feature; MODIFIER silent_mutation Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0114089932 A -> G LOC_Os01g24990-LOC_Os01g25000 intergenic_region ; MODIFIER silent_mutation Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0114089932 A -> DEL N N silent_mutation Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114089932 7.25E-06 NA mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114089932 4.82E-06 NA mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114089932 NA 7.89E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114089932 NA 2.71E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114089932 NA 1.25E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114089932 6.90E-06 NA mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251