\
| Variant ID: vg0114089932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14089932 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTAGTGTTTTCACCTATACGGTTGGCGGACTCCGCCGCCGTTGATGGGCCTCATCATCTACACCACCGGCTTGGTTCCACTGGTGCCGACTGGTGTTTTC[A/G]
TCGCCATTGATGGACGACTTTGTTCCCACATTGGTCACCTCTGCCATCATCAAGGGGAATATTACAAAGCTAAGTCATCATTAATTTTCTTTTTTATATG
CATATAAAAAAGAAAATTAATGATGACTTAGCTTTGTAATATTCCCCTTGATGATGGCAGAGGTGACCAATGTGGGAACAAAGTCGTCCATCAATGGCGA[T/C]
GAAAACACCAGTCGGCACCAGTGGAACCAAGCCGGTGGTGTAGATGATGAGGCCCATCAACGGCGGCGGAGTCCGCCAACCGTATAGGTGAAAACACTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 11.20% | 3.58% | 19.13% | NA |
| All Indica | 2759 | 71.50% | 1.20% | 0.98% | 26.28% | NA |
| All Japonica | 1512 | 59.40% | 32.10% | 8.33% | 0.13% | NA |
| Aus | 269 | 35.30% | 0.70% | 2.60% | 61.34% | NA |
| Indica I | 595 | 43.20% | 1.00% | 0.84% | 54.96% | NA |
| Indica II | 465 | 71.60% | 1.90% | 1.08% | 25.38% | NA |
| Indica III | 913 | 93.40% | 0.40% | 0.22% | 5.91% | NA |
| Indica Intermediate | 786 | 67.60% | 1.80% | 1.91% | 28.75% | NA |
| Temperate Japonica | 767 | 28.70% | 58.30% | 13.04% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 1.80% | 2.78% | 0.20% | NA |
| Japonica Intermediate | 241 | 82.20% | 12.40% | 4.98% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 10.00% | 8.89% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114089932 | A -> G | LOC_Os01g24990.1 | downstream_gene_variant ; 2897.0bp to feature; MODIFIER | silent_mutation | Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg0114089932 | A -> G | LOC_Os01g24990-LOC_Os01g25000 | intergenic_region ; MODIFIER | silent_mutation | Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg0114089932 | A -> DEL | N | N | silent_mutation | Average:51.882; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114089932 | 7.25E-06 | NA | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114089932 | 4.82E-06 | NA | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114089932 | NA | 7.89E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114089932 | NA | 2.71E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114089932 | NA | 1.25E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114089932 | 6.90E-06 | NA | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |