Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114075940:

Variant ID: vg0114075940 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14075940
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGAAATCTGTTGGTCAGCTTCCGACTTTCATTTTATTTTCTAGATTCTATGACTACAAATTCTTAGAATCCCAATAAAAATTTAAATTGTTTGGAAGCT[A/G]
AAGATTCTATCAGAAACTGAAGCTACCCTAATCATTCCCATAATTTGAGATGGAGAGAGCATATGTTTAATAAGAGCATCTCCAACAGCCTTTCCATCCC

Reverse complement sequence

GGGATGGAAAGGCTGTTGGAGATGCTCTTATTAAACATATGCTCTCTCCATCTCAAATTATGGGAATGATTAGGGTAGCTTCAGTTTCTGATAGAATCTT[T/C]
AGCTTCCAAACAATTTAAATTTTTATTGGGATTCTAAGAATTTGTAGTCATAGAATCTAGAAAATAAAATGAAAGTCGGAAGCTGACCAACAGATTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	20.80%	0.00%	0.00%	NA
All Indica	2759	71.60%	28.40%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	33.50%	66.50%	0.00%	0.00%	NA
Indica I	595	43.00%	57.00%	0.00%	0.00%	NA
Indica II	465	72.50%	27.50%	0.00%	0.00%	NA
Indica III	913	93.40%	6.60%	0.00%	0.00%	NA
Indica Intermediate	786	67.30%	32.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114075940	A -> G	LOC_Os01g24970.1	upstream_gene_variant ; 381.0bp to feature; MODIFIER	silent_mutation	Average:48.45; most accessible tissue: Callus, score: 75.192	N	N	N	N
vg0114075940	A -> G	LOC_Os01g24980.1	upstream_gene_variant ; 1689.0bp to feature; MODIFIER	silent_mutation	Average:48.45; most accessible tissue: Callus, score: 75.192	N	N	N	N
vg0114075940	A -> G	LOC_Os01g24980.2	upstream_gene_variant ; 3287.0bp to feature; MODIFIER	silent_mutation	Average:48.45; most accessible tissue: Callus, score: 75.192	N	N	N	N
vg0114075940	A -> G	LOC_Os01g24960-LOC_Os01g24970	intergenic_region ; MODIFIER	silent_mutation	Average:48.45; most accessible tissue: Callus, score: 75.192	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114075940	NA	7.66E-15	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	2.99E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	3.04E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	1.54E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	1.92E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	4.43E-08	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	6.91E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	1.48E-08	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	2.76E-08	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	7.60E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	7.26E-07	mr1211	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	8.89E-09	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	5.22E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	7.83E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	5.86E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	2.31E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	3.50E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	1.28E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114075940	NA	3.99E-08	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251