\
| Variant ID: vg0114075940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14075940 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAGAAATCTGTTGGTCAGCTTCCGACTTTCATTTTATTTTCTAGATTCTATGACTACAAATTCTTAGAATCCCAATAAAAATTTAAATTGTTTGGAAGCT[A/G]
AAGATTCTATCAGAAACTGAAGCTACCCTAATCATTCCCATAATTTGAGATGGAGAGAGCATATGTTTAATAAGAGCATCTCCAACAGCCTTTCCATCCC
GGGATGGAAAGGCTGTTGGAGATGCTCTTATTAAACATATGCTCTCTCCATCTCAAATTATGGGAATGATTAGGGTAGCTTCAGTTTCTGATAGAATCTT[T/C]
AGCTTCCAAACAATTTAAATTTTTATTGGGATTCTAAGAATTTGTAGTCATAGAATCTAGAAAATAAAATGAAAGTCGGAAGCTGACCAACAGATTTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 33.50% | 66.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.00% | 57.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114075940 | A -> G | LOC_Os01g24970.1 | upstream_gene_variant ; 381.0bp to feature; MODIFIER | silent_mutation | Average:48.45; most accessible tissue: Callus, score: 75.192 | N | N | N | N |
| vg0114075940 | A -> G | LOC_Os01g24980.1 | upstream_gene_variant ; 1689.0bp to feature; MODIFIER | silent_mutation | Average:48.45; most accessible tissue: Callus, score: 75.192 | N | N | N | N |
| vg0114075940 | A -> G | LOC_Os01g24980.2 | upstream_gene_variant ; 3287.0bp to feature; MODIFIER | silent_mutation | Average:48.45; most accessible tissue: Callus, score: 75.192 | N | N | N | N |
| vg0114075940 | A -> G | LOC_Os01g24960-LOC_Os01g24970 | intergenic_region ; MODIFIER | silent_mutation | Average:48.45; most accessible tissue: Callus, score: 75.192 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114075940 | NA | 7.66E-15 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 2.99E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 3.04E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 1.54E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 1.92E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 4.43E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 6.91E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 1.48E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 2.76E-08 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 7.60E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 7.26E-07 | mr1211 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 8.89E-09 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 5.22E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 7.83E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 5.86E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 2.31E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 3.50E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 1.28E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114075940 | NA | 3.99E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |