Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0114073794:

Variant ID: vg0114073794 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14073794
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGACAGCTGGGTGCAGGCGGGCCAAAGTACCGTATGGAAAAATGGATATGCCCGCACGGGAAAATGAGTTATGTAGTAGTGCGTAGACAGCGAGGCGC[T/C]
TGTGGTGACTTCGTCATTCTCAAGGATTTGTCGGCCCAGTCTTCGGAGATGCTCATAGGGGTAGGATTTACGTGCGTGCGTTCATAGGGGCGAGTGCACG

Reverse complement sequence

CGTGCACTCGCCCCTATGAACGCACGCACGTAAATCCTACCCCTATGAGCATCTCCGAAGACTGGGCCGACAAATCCTTGAGAATGACGAAGTCACCACA[A/G]
GCGCCTCGCTGTCTACGCACTACTACATAACTCATTTTCCCGTGCGGGCATATCCATTTTTCCATACGGTACTTTGGCCCGCCTGCACCCAGCTGTCTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	12.70%	3.24%	20.33%	NA
All Indica	2759	68.20%	3.40%	0.51%	27.87%	NA
All Japonica	1512	58.50%	32.90%	8.53%	0.13%	NA
Aus	269	33.50%	0.00%	1.49%	65.06%	NA
Indica I	595	42.40%	0.30%	0.67%	56.64%	NA
Indica II	465	71.00%	1.70%	0.00%	27.31%	NA
Indica III	913	86.20%	7.10%	0.33%	6.35%	NA
Indica Intermediate	786	65.40%	2.30%	0.89%	31.42%	NA
Temperate Japonica	767	27.80%	59.60%	12.65%	0.00%	NA
Tropical Japonica	504	94.60%	1.80%	3.37%	0.20%	NA
Japonica Intermediate	241	80.50%	12.90%	6.22%	0.41%	NA
VI/Aromatic	96	96.90%	1.00%	2.08%	0.00%	NA
Intermediate	90	68.90%	10.00%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114073794	T -> DEL	N	N	silent_mutation	Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0114073794	T -> C	LOC_Os01g24960.1	upstream_gene_variant ; 4290.0bp to feature; MODIFIER	silent_mutation	Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0114073794	T -> C	LOC_Os01g24970.1	upstream_gene_variant ; 2527.0bp to feature; MODIFIER	silent_mutation	Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0114073794	T -> C	LOC_Os01g24980.1	upstream_gene_variant ; 3835.0bp to feature; MODIFIER	silent_mutation	Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N
vg0114073794	T -> C	LOC_Os01g24960-LOC_Os01g24970	intergenic_region ; MODIFIER	silent_mutation	Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114073794	NA	6.47E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	4.50E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	6.41E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	5.68E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	4.05E-08	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	2.21E-06	mr1555	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	2.42E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	4.67E-06	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	4.88E-07	1.96E-19	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794	NA	3.54E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251