\
| Variant ID: vg0114073794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14073794 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAGACAGCTGGGTGCAGGCGGGCCAAAGTACCGTATGGAAAAATGGATATGCCCGCACGGGAAAATGAGTTATGTAGTAGTGCGTAGACAGCGAGGCGC[T/C]
TGTGGTGACTTCGTCATTCTCAAGGATTTGTCGGCCCAGTCTTCGGAGATGCTCATAGGGGTAGGATTTACGTGCGTGCGTTCATAGGGGCGAGTGCACG
CGTGCACTCGCCCCTATGAACGCACGCACGTAAATCCTACCCCTATGAGCATCTCCGAAGACTGGGCCGACAAATCCTTGAGAATGACGAAGTCACCACA[A/G]
GCGCCTCGCTGTCTACGCACTACTACATAACTCATTTTCCCGTGCGGGCATATCCATTTTTCCATACGGTACTTTGGCCCGCCTGCACCCAGCTGTCTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 12.70% | 3.24% | 20.33% | NA |
| All Indica | 2759 | 68.20% | 3.40% | 0.51% | 27.87% | NA |
| All Japonica | 1512 | 58.50% | 32.90% | 8.53% | 0.13% | NA |
| Aus | 269 | 33.50% | 0.00% | 1.49% | 65.06% | NA |
| Indica I | 595 | 42.40% | 0.30% | 0.67% | 56.64% | NA |
| Indica II | 465 | 71.00% | 1.70% | 0.00% | 27.31% | NA |
| Indica III | 913 | 86.20% | 7.10% | 0.33% | 6.35% | NA |
| Indica Intermediate | 786 | 65.40% | 2.30% | 0.89% | 31.42% | NA |
| Temperate Japonica | 767 | 27.80% | 59.60% | 12.65% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 1.80% | 3.37% | 0.20% | NA |
| Japonica Intermediate | 241 | 80.50% | 12.90% | 6.22% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 10.00% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114073794 | T -> DEL | N | N | silent_mutation | Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0114073794 | T -> C | LOC_Os01g24960.1 | upstream_gene_variant ; 4290.0bp to feature; MODIFIER | silent_mutation | Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0114073794 | T -> C | LOC_Os01g24970.1 | upstream_gene_variant ; 2527.0bp to feature; MODIFIER | silent_mutation | Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0114073794 | T -> C | LOC_Os01g24980.1 | upstream_gene_variant ; 3835.0bp to feature; MODIFIER | silent_mutation | Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0114073794 | T -> C | LOC_Os01g24960-LOC_Os01g24970 | intergenic_region ; MODIFIER | silent_mutation | Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114073794 | NA | 6.47E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 4.50E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 6.41E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 5.68E-08 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 4.05E-08 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 2.21E-06 | mr1555 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 2.42E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 4.67E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | 4.88E-07 | 1.96E-19 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114073794 | NA | 3.54E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |