\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114073794:

Variant ID: vg0114073794 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14073794
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGACAGCTGGGTGCAGGCGGGCCAAAGTACCGTATGGAAAAATGGATATGCCCGCACGGGAAAATGAGTTATGTAGTAGTGCGTAGACAGCGAGGCGC[T/C]
TGTGGTGACTTCGTCATTCTCAAGGATTTGTCGGCCCAGTCTTCGGAGATGCTCATAGGGGTAGGATTTACGTGCGTGCGTTCATAGGGGCGAGTGCACG

Reverse complement sequence

CGTGCACTCGCCCCTATGAACGCACGCACGTAAATCCTACCCCTATGAGCATCTCCGAAGACTGGGCCGACAAATCCTTGAGAATGACGAAGTCACCACA[A/G]
GCGCCTCGCTGTCTACGCACTACTACATAACTCATTTTCCCGTGCGGGCATATCCATTTTTCCATACGGTACTTTGGCCCGCCTGCACCCAGCTGTCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 12.70% 3.24% 20.33% NA
All Indica  2759 68.20% 3.40% 0.51% 27.87% NA
All Japonica  1512 58.50% 32.90% 8.53% 0.13% NA
Aus  269 33.50% 0.00% 1.49% 65.06% NA
Indica I  595 42.40% 0.30% 0.67% 56.64% NA
Indica II  465 71.00% 1.70% 0.00% 27.31% NA
Indica III  913 86.20% 7.10% 0.33% 6.35% NA
Indica Intermediate  786 65.40% 2.30% 0.89% 31.42% NA
Temperate Japonica  767 27.80% 59.60% 12.65% 0.00% NA
Tropical Japonica  504 94.60% 1.80% 3.37% 0.20% NA
Japonica Intermediate  241 80.50% 12.90% 6.22% 0.41% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 68.90% 10.00% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114073794 T -> DEL N N silent_mutation Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0114073794 T -> C LOC_Os01g24960.1 upstream_gene_variant ; 4290.0bp to feature; MODIFIER silent_mutation Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0114073794 T -> C LOC_Os01g24970.1 upstream_gene_variant ; 2527.0bp to feature; MODIFIER silent_mutation Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0114073794 T -> C LOC_Os01g24980.1 upstream_gene_variant ; 3835.0bp to feature; MODIFIER silent_mutation Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0114073794 T -> C LOC_Os01g24960-LOC_Os01g24970 intergenic_region ; MODIFIER silent_mutation Average:66.482; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114073794 NA 6.47E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 4.50E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 6.41E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 5.68E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 4.05E-08 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 2.21E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 2.42E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 4.67E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 4.88E-07 1.96E-19 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114073794 NA 3.54E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251