\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114066125:

Variant ID: vg0114066125 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14066125
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CATCGCCGATGGTCTTCTTCAACAAGGGAACACGCCGCCGCCGCTCGTTCACAAGGATGGACATCCCGCGTCCTATGATAGATTAATCTACAAGCCGCTT[T/C]
ATCGACGATATCGACCGTGTCCTTTACGACGGCAACGACCGCGTCACCGACGACGGCGTCGATCACGTCATCTACGACGACAACGACTGCATCAACTCGG

Reverse complement sequence

CCGAGTTGATGCAGTCGTTGTCGTCGTAGATGACGTGATCGACGCCGTCGTCGGTGACGCGGTCGTTGCCGTCGTAAAGGACACGGTCGATATCGTCGAT[A/G]
AAGCGGCTTGTAGATTAATCTATCATAGGACGCGGGATGTCCATCCTTGTGAACGAGCGGCGGCGGCGTGTTCCCTTGTTGAAGAAGACCATCGGCGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 33.10% 0.63% 13.92% NA
All Indica  2759 74.30% 1.30% 1.01% 23.38% NA
All Japonica  1512 4.80% 95.10% 0.00% 0.13% NA
Aus  269 98.10% 0.70% 0.37% 0.74% NA
Indica I  595 47.10% 1.00% 1.34% 50.59% NA
Indica II  465 59.40% 2.80% 2.58% 35.27% NA
Indica III  913 98.00% 0.30% 0.00% 1.64% NA
Indica Intermediate  786 76.20% 1.80% 1.02% 20.99% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 10.70% 89.10% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 42.20% 46.70% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114066125 T -> DEL N N silent_mutation Average:84.289; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N
vg0114066125 T -> C LOC_Os01g24950.1 downstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N
vg0114066125 T -> C LOC_Os01g24960.1 downstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N
vg0114066125 T -> C LOC_Os01g24950.2 downstream_gene_variant ; 1220.0bp to feature; MODIFIER silent_mutation Average:84.289; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N
vg0114066125 T -> C LOC_Os01g24950-LOC_Os01g24960 intergenic_region ; MODIFIER silent_mutation Average:84.289; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114066125 T C -0.04 -0.04 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114066125 2.29E-06 2.29E-06 mr1483 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066125 NA 5.77E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066125 NA 8.20E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066125 NA 7.84E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251