\
| Variant ID: vg0114056307 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14056307 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )
ATCCTTGCACACTAACACCTTCTTCCAGCAACTTCAAGATGAGGGCGAGCTTGGAGAATCCATGGGGATGCCTAGGGTGCAAGCCGCATTGCGCTGCCTC[T/C]
CGCCGCTAATCCGATCGCACTGTACCACCGCTAACCCCGCTGCACTGCGCTGCCTCCTGTCGCTAATCTCACCACCGAGGCCGCCAAAGCCGCTACCTCT
AGAGGTAGCGGCTTTGGCGGCCTCGGTGGTGAGATTAGCGACAGGAGGCAGCGCAGTGCAGCGGGGTTAGCGGTGGTACAGTGCGATCGGATTAGCGGCG[A/G]
GAGGCAGCGCAATGCGGCTTGCACCCTAGGCATCCCCATGGATTCTCCAAGCTCGCCCTCATCTTGAAGTTGCTGGAAGAAGGTGTTAGTGTGCAAGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.20% | 33.10% | 0.51% | 14.24% | NA |
| All Indica | 2759 | 74.00% | 1.30% | 0.87% | 23.89% | NA |
| All Japonica | 1512 | 4.80% | 95.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 98.10% | 0.70% | 0.00% | 1.12% | NA |
| Indica I | 595 | 46.90% | 0.70% | 1.18% | 51.26% | NA |
| Indica II | 465 | 58.50% | 3.00% | 1.51% | 36.99% | NA |
| Indica III | 913 | 98.00% | 0.30% | 0.00% | 1.64% | NA |
| Indica Intermediate | 786 | 75.70% | 1.80% | 1.27% | 21.25% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 45.60% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114056307 | T -> DEL | N | N | silent_mutation | Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0114056307 | T -> C | LOC_Os01g24950.1 | upstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0114056307 | T -> C | LOC_Os01g24950.2 | upstream_gene_variant ; 3292.0bp to feature; MODIFIER | silent_mutation | Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0114056307 | T -> C | LOC_Os01g24940.1 | downstream_gene_variant ; 1397.0bp to feature; MODIFIER | silent_mutation | Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| vg0114056307 | T -> C | LOC_Os01g24940-LOC_Os01g24950 | intergenic_region ; MODIFIER | silent_mutation | Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114056307 | NA | 2.36E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 4.53E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 1.87E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | 6.56E-06 | 8.22E-06 | mr1637 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 3.52E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 5.31E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 1.43E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114056307 | NA | 3.45E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |