\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114056307:

Variant ID: vg0114056307 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14056307
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTTGCACACTAACACCTTCTTCCAGCAACTTCAAGATGAGGGCGAGCTTGGAGAATCCATGGGGATGCCTAGGGTGCAAGCCGCATTGCGCTGCCTC[T/C]
CGCCGCTAATCCGATCGCACTGTACCACCGCTAACCCCGCTGCACTGCGCTGCCTCCTGTCGCTAATCTCACCACCGAGGCCGCCAAAGCCGCTACCTCT

Reverse complement sequence

AGAGGTAGCGGCTTTGGCGGCCTCGGTGGTGAGATTAGCGACAGGAGGCAGCGCAGTGCAGCGGGGTTAGCGGTGGTACAGTGCGATCGGATTAGCGGCG[A/G]
GAGGCAGCGCAATGCGGCTTGCACCCTAGGCATCCCCATGGATTCTCCAAGCTCGCCCTCATCTTGAAGTTGCTGGAAGAAGGTGTTAGTGTGCAAGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 33.10% 0.51% 14.24% NA
All Indica  2759 74.00% 1.30% 0.87% 23.89% NA
All Japonica  1512 4.80% 95.10% 0.00% 0.13% NA
Aus  269 98.10% 0.70% 0.00% 1.12% NA
Indica I  595 46.90% 0.70% 1.18% 51.26% NA
Indica II  465 58.50% 3.00% 1.51% 36.99% NA
Indica III  913 98.00% 0.30% 0.00% 1.64% NA
Indica Intermediate  786 75.70% 1.80% 1.27% 21.25% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 10.70% 89.10% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 44.40% 45.60% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114056307 T -> DEL N N silent_mutation Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0114056307 T -> C LOC_Os01g24950.1 upstream_gene_variant ; 3265.0bp to feature; MODIFIER silent_mutation Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0114056307 T -> C LOC_Os01g24950.2 upstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0114056307 T -> C LOC_Os01g24940.1 downstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0114056307 T -> C LOC_Os01g24940-LOC_Os01g24950 intergenic_region ; MODIFIER silent_mutation Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114056307 NA 2.36E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 4.53E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 1.87E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 6.56E-06 8.22E-06 mr1637 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 3.52E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 5.31E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 1.43E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307 NA 3.45E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251