\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114026298:

Variant ID: vg0114026298 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14026298
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGCTCATGGACGACTGCGAGAGAGGGAGAGAGATGGCGGCGGCGGCTGTGGAGCGGCCGGCAGCGGTGGAGAGGTCGGCGGCGCGGTGGAGGGGCCGG[C/T,A]
GGGGTAGCGGTCAGTGGCAGCGGAGCGGTGGAGCGGCCCTCGTGTCGGGGCACAGGTACTCCAATTGCATATTCATCTTTGAGGTAATCGATACAGCACT

Reverse complement sequence

AGTGCTGTATCGATTACCTCAAAGATGAATATGCAATTGGAGTACCTGTGCCCCGACACGAGGGCCGCTCCACCGCTCCGCTGCCACTGACCGCTACCCC[G/A,T]
CCGGCCCCTCCACCGCGCCGCCGACCTCTCCACCGCTGCCGGCCGCTCCACAGCCGCCGCCGCCATCTCTCTCCCTCTCTCGCAGTCGTCCATGAGCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 11.00% 0.02% 0.00% A: 0.02%
All Indica  2759 87.90% 12.00% 0.04% 0.00% A: 0.04%
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 33.50% 66.50% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 79.70% 20.20% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 84.70% 15.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114026298 C -> T LOC_Os01g24900.1 missense_variant ; p.Arg78Trp; MODERATE nonsynonymous_codon ; R78W Average:58.783; most accessible tissue: Minghui63 young leaf, score: 79.191 unknown unknown TOLERATED 0.15
vg0114026298 C -> A LOC_Os01g24900.1 synonymous_variant ; p.Arg78Arg; LOW synonymous_codon Average:58.783; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114026298 NA 5.56E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 2.53E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 4.29E-12 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 1.09E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 7.94E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 5.04E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 4.43E-06 1.19E-14 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 1.70E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 2.08E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 9.87E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114026298 NA 7.18E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251