Variant ID: vg0114026298 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 14026298 |
Reference Allele: C | Alternative Allele: T,A |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCGCTCATGGACGACTGCGAGAGAGGGAGAGAGATGGCGGCGGCGGCTGTGGAGCGGCCGGCAGCGGTGGAGAGGTCGGCGGCGCGGTGGAGGGGCCGG[C/T,A]
GGGGTAGCGGTCAGTGGCAGCGGAGCGGTGGAGCGGCCCTCGTGTCGGGGCACAGGTACTCCAATTGCATATTCATCTTTGAGGTAATCGATACAGCACT
AGTGCTGTATCGATTACCTCAAAGATGAATATGCAATTGGAGTACCTGTGCCCCGACACGAGGGCCGCTCCACCGCTCCGCTGCCACTGACCGCTACCCC[G/A,T]
CCGGCCCCTCCACCGCGCCGCCGACCTCTCCACCGCTGCCGGCCGCTCCACAGCCGCCGCCGCCATCTCTCTCCCTCTCTCGCAGTCGTCCATGAGCGGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.00% | 11.00% | 0.02% | 0.00% | A: 0.02% |
All Indica | 2759 | 87.90% | 12.00% | 0.04% | 0.00% | A: 0.04% |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 33.50% | 66.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 79.70% | 20.20% | 0.00% | 0.00% | A: 0.11% |
Indica Intermediate | 786 | 84.70% | 15.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0114026298 | C -> T | LOC_Os01g24900.1 | missense_variant ; p.Arg78Trp; MODERATE | nonsynonymous_codon ; R78W | Average:58.783; most accessible tissue: Minghui63 young leaf, score: 79.191 | unknown | unknown | TOLERATED | 0.15 |
vg0114026298 | C -> A | LOC_Os01g24900.1 | synonymous_variant ; p.Arg78Arg; LOW | synonymous_codon | Average:58.783; most accessible tissue: Minghui63 young leaf, score: 79.191 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0114026298 | NA | 5.56E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 2.53E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 4.29E-12 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 1.09E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 7.94E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 5.04E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | 4.43E-06 | 1.19E-14 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 1.70E-12 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 2.08E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 9.87E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0114026298 | NA | 7.18E-13 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |