\
| Variant ID: vg0114024172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14024172 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 259. )
GTTGGCATACATCGAAAACGGTGTGCGTCCCATCTTCACAAATTTCATGTTCAAGGTGGTTTTCCAACCACGCCAAGACTTGGCCATTGTTTGCAGTGCA[C/A]
AATTCCTCACTGCTGCCTCTGATCCATCCGGGAACTGGAAGATTTTCTTCAACTCTTTCCATAGGACTTCCTTATTCCCATTCGATACATGATCCTAGTC
GACTAGGATCATGTATCGAATGGGAATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATT[G/T]
TGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACATGAAATTTGTGAAGATGGGACGCACACCGTTTTCGATGTATGCCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 23.30% | 3.07% | 1.10% | NA |
| All Indica | 2759 | 60.70% | 32.60% | 4.93% | 1.74% | NA |
| All Japonica | 1512 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.40% | 28.60% | 2.23% | 0.74% | NA |
| Indica I | 595 | 59.70% | 38.30% | 1.68% | 0.34% | NA |
| Indica II | 465 | 89.50% | 8.60% | 1.29% | 0.65% | NA |
| Indica III | 913 | 46.90% | 41.50% | 8.32% | 3.29% | NA |
| Indica Intermediate | 786 | 60.70% | 32.10% | 5.60% | 1.65% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 44.80% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114024172 | C -> A | LOC_Os01g24890.1 | upstream_gene_variant ; 14.0bp to feature; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> A | LOC_Os01g24900.1 | upstream_gene_variant ; 1895.0bp to feature; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> A | LOC_Os01g24880.1 | downstream_gene_variant ; 4707.0bp to feature; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> A | LOC_Os01g24910.1 | downstream_gene_variant ; 2619.0bp to feature; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> A | LOC_Os01g24880.2 | downstream_gene_variant ; 4707.0bp to feature; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> A | LOC_Os01g24890-LOC_Os01g24900 | intergenic_region ; MODIFIER | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg0114024172 | C -> DEL | N | N | silent_mutation | Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114024172 | NA | 1.11E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114024172 | NA | 2.50E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114024172 | NA | 4.86E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114024172 | 2.20E-07 | NA | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114024172 | 4.35E-07 | 8.94E-15 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |