Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114024172:

Variant ID: vg0114024172 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14024172
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGGCATACATCGAAAACGGTGTGCGTCCCATCTTCACAAATTTCATGTTCAAGGTGGTTTTCCAACCACGCCAAGACTTGGCCATTGTTTGCAGTGCA[C/A]
AATTCCTCACTGCTGCCTCTGATCCATCCGGGAACTGGAAGATTTTCTTCAACTCTTTCCATAGGACTTCCTTATTCCCATTCGATACATGATCCTAGTC

Reverse complement sequence

GACTAGGATCATGTATCGAATGGGAATAAGGAAGTCCTATGGAAAGAGTTGAAGAAAATCTTCCAGTTCCCGGATGGATCAGAGGCAGCAGTGAGGAATT[G/T]
TGCACTGCAAACAATGGCCAAGTCTTGGCGTGGTTGGAAAACCACCTTGAACATGAAATTTGTGAAGATGGGACGCACACCGTTTTCGATGTATGCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	23.30%	3.07%	1.10%	NA
All Indica	2759	60.70%	32.60%	4.93%	1.74%	NA
All Japonica	1512	95.30%	4.70%	0.00%	0.00%	NA
Aus	269	68.40%	28.60%	2.23%	0.74%	NA
Indica I	595	59.70%	38.30%	1.68%	0.34%	NA
Indica II	465	89.50%	8.60%	1.29%	0.65%	NA
Indica III	913	46.90%	41.50%	8.32%	3.29%	NA
Indica Intermediate	786	60.70%	32.10%	5.60%	1.65%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	44.80%	2.08%	1.04%	NA
Intermediate	90	87.80%	10.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114024172	C -> A	LOC_Os01g24890.1	upstream_gene_variant ; 14.0bp to feature; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> A	LOC_Os01g24900.1	upstream_gene_variant ; 1895.0bp to feature; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> A	LOC_Os01g24880.1	downstream_gene_variant ; 4707.0bp to feature; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> A	LOC_Os01g24910.1	downstream_gene_variant ; 2619.0bp to feature; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> A	LOC_Os01g24880.2	downstream_gene_variant ; 4707.0bp to feature; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> A	LOC_Os01g24890-LOC_Os01g24900	intergenic_region ; MODIFIER	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0114024172	C -> DEL	N	N	silent_mutation	Average:37.066; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114024172	NA	1.11E-07	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114024172	NA	2.50E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114024172	NA	4.86E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114024172	2.20E-07	NA	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114024172	4.35E-07	8.94E-15	mr1519_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251