\
| Variant ID: vg0113992286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13992286 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 94. )
GTTATTGATCAGTTTCGACCGTCAATATTACCAAAATAGAGGAGAACTAGTGATGCTTGCAATGCATATACATGTTAGAATAATAATATTCCACTAGGTT[T/C]
ACTAACCTTTTGTAGAGAATAACCATAAAGTGGAGGAGAATCGACATCAACTCAAACGATAAATTAATCGGACGATGTCGAGAATCAGACTTATGCATGA
TCATGCATAAGTCTGATTCTCGACATCGTCCGATTAATTTATCGTTTGAGTTGATGTCGATTCTCCTCCACTTTATGGTTATTCTCTACAAAAGGTTAGT[A/G]
AACCTAGTGGAATATTATTATTCTAACATGTATATGCATTGCAAGCATCACTAGTTCTCCTCTATTTTGGTAATATTGACGGTCGAAACTGATCAATAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.20% | 36.30% | 13.22% | 7.26% | NA |
| All Indica | 2759 | 61.30% | 6.20% | 20.37% | 12.14% | NA |
| All Japonica | 1512 | 4.40% | 95.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 79.60% | 3.00% | 15.99% | 1.49% | NA |
| Indica I | 595 | 66.40% | 4.50% | 28.24% | 0.84% | NA |
| Indica II | 465 | 61.10% | 8.20% | 19.78% | 10.97% | NA |
| Indica III | 913 | 54.70% | 4.70% | 16.76% | 23.88% | NA |
| Indica Intermediate | 786 | 65.40% | 7.90% | 18.96% | 7.76% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.50% | 90.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 51.00% | 6.25% | 1.04% | NA |
| Intermediate | 90 | 31.10% | 51.10% | 14.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113992286 | T -> DEL | N | N | silent_mutation | Average:27.304; most accessible tissue: Callus, score: 51.369 | N | N | N | N |
| vg0113992286 | T -> C | LOC_Os01g24840.1 | upstream_gene_variant ; 3575.0bp to feature; MODIFIER | silent_mutation | Average:27.304; most accessible tissue: Callus, score: 51.369 | N | N | N | N |
| vg0113992286 | T -> C | LOC_Os01g24840-LOC_Os01g24860 | intergenic_region ; MODIFIER | silent_mutation | Average:27.304; most accessible tissue: Callus, score: 51.369 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113992286 | NA | 6.47E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 6.38E-45 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 2.84E-60 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 3.92E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 4.26E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 3.01E-19 | mr1416_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 8.27E-44 | mr1519_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 7.08E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 1.46E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113992286 | NA | 2.15E-32 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |