\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113992286:

Variant ID: vg0113992286 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13992286
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATTGATCAGTTTCGACCGTCAATATTACCAAAATAGAGGAGAACTAGTGATGCTTGCAATGCATATACATGTTAGAATAATAATATTCCACTAGGTT[T/C]
ACTAACCTTTTGTAGAGAATAACCATAAAGTGGAGGAGAATCGACATCAACTCAAACGATAAATTAATCGGACGATGTCGAGAATCAGACTTATGCATGA

Reverse complement sequence

TCATGCATAAGTCTGATTCTCGACATCGTCCGATTAATTTATCGTTTGAGTTGATGTCGATTCTCCTCCACTTTATGGTTATTCTCTACAAAAGGTTAGT[A/G]
AACCTAGTGGAATATTATTATTCTAACATGTATATGCATTGCAAGCATCACTAGTTCTCCTCTATTTTGGTAATATTGACGGTCGAAACTGATCAATAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 36.30% 13.22% 7.26% NA
All Indica  2759 61.30% 6.20% 20.37% 12.14% NA
All Japonica  1512 4.40% 95.50% 0.07% 0.00% NA
Aus  269 79.60% 3.00% 15.99% 1.49% NA
Indica I  595 66.40% 4.50% 28.24% 0.84% NA
Indica II  465 61.10% 8.20% 19.78% 10.97% NA
Indica III  913 54.70% 4.70% 16.76% 23.88% NA
Indica Intermediate  786 65.40% 7.90% 18.96% 7.76% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 9.50% 90.30% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 51.00% 6.25% 1.04% NA
Intermediate  90 31.10% 51.10% 14.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113992286 T -> DEL N N silent_mutation Average:27.304; most accessible tissue: Callus, score: 51.369 N N N N
vg0113992286 T -> C LOC_Os01g24840.1 upstream_gene_variant ; 3575.0bp to feature; MODIFIER silent_mutation Average:27.304; most accessible tissue: Callus, score: 51.369 N N N N
vg0113992286 T -> C LOC_Os01g24840-LOC_Os01g24860 intergenic_region ; MODIFIER silent_mutation Average:27.304; most accessible tissue: Callus, score: 51.369 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113992286 NA 6.47E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 6.38E-45 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 2.84E-60 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 3.92E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 4.26E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 3.01E-19 mr1416_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 8.27E-44 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 7.08E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 1.46E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113992286 NA 2.15E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251