Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113990076:

Variant ID: vg0113990076 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13990076
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAGTGATTATACCTTAGAGCAGGTACAATAGCAGGCTATAAGCCAGTTATAAATATATTTTAAAGAGATAAAGGAAGAGAGAGAAGAGCAGCAGGCTA[T/C]
AGATCTGTAGCCGCTGTAACACGGACTCCAAGACGTAATGTGTGTATGACAGGTGGGACCAAATATTAATAGTATAGTAAGCTACTATTATATGAGTTGG

Reverse complement sequence

CCAACTCATATAATAGTAGCTTACTATACTATTAATATTTGGTCCCACCTGTCATACACACATTACGTCTTGGAGTCCGTGTTACAGCGGCTACAGATCT[A/G]
TAGCCTGCTGCTCTTCTCTCTCTTCCTTTATCTCTTTAAAATATATTTATAACTGGCTTATAGCCTGCTATTGTACCTGCTCTAAGGTATAATCACTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	9.90%	3.79%	0.00%	NA
All Indica	2759	99.50%	0.30%	0.14%	0.00%	NA
All Japonica	1512	58.70%	30.00%	11.31%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.30%	0.38%	0.00%	NA
Temperate Japonica	767	28.90%	55.70%	15.38%	0.00%	NA
Tropical Japonica	504	94.40%	0.60%	4.96%	0.00%	NA
Japonica Intermediate	241	78.80%	9.50%	11.62%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	5.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113990076	T -> C	LOC_Os01g24840.1	upstream_gene_variant ; 1365.0bp to feature; MODIFIER	silent_mutation	Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0113990076	T -> C	LOC_Os01g24830.1	downstream_gene_variant ; 4396.0bp to feature; MODIFIER	silent_mutation	Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0113990076	T -> C	LOC_Os01g24840-LOC_Os01g24860	intergenic_region ; MODIFIER	silent_mutation	Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113990076	NA	6.76E-06	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.91E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	5.76E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.31E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	4.66E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	4.27E-08	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	5.47E-08	mr1205	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	4.27E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.66E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.31E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	7.11E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.61E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	5.07E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.32E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	4.77E-07	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.09E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.21E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.24E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.06E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	7.48E-06	NA	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.53E-10	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.52E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	3.32E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.64E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.00E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	1.49E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.23E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076	NA	2.25E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251