Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113976460:

Variant ID: vg0113976460 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13976460
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TTATATTATTCAAATATATTAAAATGACAACCTAATTTTAAATTTTGTAATAACTTTATAAAACTACTAATGTGTAATATTCATATTGTATTTTATATAC[G/A]
TGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATAAATATTCTTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTTT

Reverse complement sequence

AAAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAAGAATATTTATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACA[C/T]
GTATATAAAATACAATATGAATATTACACATTAGTAGTTTTATAAAGTTATTACAAAATTTAAAATTAGGTTGTCATTTTAATATATTTGAATAATATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	4.90%	0.23%	0.25%	NA
All Indica	2759	92.30%	6.90%	0.40%	0.43%	NA
All Japonica	1512	97.30%	2.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	86.60%	13.10%	0.00%	0.34%	NA
Indica II	465	94.80%	2.40%	1.51%	1.29%	NA
Indica III	913	96.20%	3.70%	0.00%	0.11%	NA
Indica Intermediate	786	90.70%	8.40%	0.51%	0.38%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113976460	G -> A	LOC_Os01g24810.1	upstream_gene_variant ; 1504.0bp to feature; MODIFIER	silent_mutation	Average:16.339; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0113976460	G -> A	LOC_Os01g24820.1	downstream_gene_variant ; 3425.0bp to feature; MODIFIER	silent_mutation	Average:16.339; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0113976460	G -> A	LOC_Os01g24800-LOC_Os01g24810	intergenic_region ; MODIFIER	silent_mutation	Average:16.339; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0113976460	G -> DEL	N	N	silent_mutation	Average:16.339; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113976460	NA	3.20E-08	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	NA	5.22E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	NA	3.58E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	NA	1.77E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	5.73E-07	3.62E-09	mr1679	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	NA	4.13E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976460	NA	5.19E-07	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251