\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113976407:

Variant ID: vg0113976407 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13976407
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGCTAGCATCATTATATTTTCTCTCATATAATAGCATATTTGTTTTCTCATTATATTATTCAAATATATTAAAATGACAACCTAATTTTAAATTTTG[T/C]
AATAACTTTATAAAACTACTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAA

Reverse complement sequence

TTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAGTAGTTTTATAAAGTTATT[A/G]
CAAAATTTAAAATTAGGTTGTCATTTTAATATATTTGAATAATATAATGAGAAAACAAATATGCTATTATATGAGAGAAAATATAATGATGCTAGCCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 30.50% 13.75% 2.81% NA
All Indica  2759 71.90% 1.60% 21.96% 4.49% NA
All Japonica  1512 11.00% 88.90% 0.07% 0.00% NA
Aus  269 85.10% 0.40% 11.52% 2.97% NA
Indica I  595 78.00% 0.80% 15.46% 5.71% NA
Indica II  465 73.30% 2.60% 18.06% 6.02% NA
Indica III  913 65.90% 1.10% 30.67% 2.30% NA
Indica Intermediate  786 73.40% 2.30% 19.08% 5.22% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 25.20% 74.80% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 89.60% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 13.50% 4.17% 0.00% NA
Intermediate  90 45.60% 44.40% 8.89% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113976407 T -> DEL N N silent_mutation Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0113976407 T -> C LOC_Os01g24810.1 upstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0113976407 T -> C LOC_Os01g24820.1 downstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0113976407 T -> C LOC_Os01g24800-LOC_Os01g24810 intergenic_region ; MODIFIER silent_mutation Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113976407 NA 1.58E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113976407 NA 1.12E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.99E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.09E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 6.14E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.48E-17 mr1361 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.35E-22 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.37E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.61E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 4.14E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.71E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 5.30E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.68E-64 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 9.89E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.15E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 8.49E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 2.69E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 9.41E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 2.78E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 3.22E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.21E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 4.47E-20 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 5.76E-15 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 6.82E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.70E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 7.37E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.65E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407 NA 1.65E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251