Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113976407:

Variant ID: vg0113976407 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13976407
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CGCGGCTAGCATCATTATATTTTCTCTCATATAATAGCATATTTGTTTTCTCATTATATTATTCAAATATATTAAAATGACAACCTAATTTTAAATTTTG[T/C]
AATAACTTTATAAAACTACTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAA

Reverse complement sequence

TTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAGTAGTTTTATAAAGTTATT[A/G]
CAAAATTTAAAATTAGGTTGTCATTTTAATATATTTGAATAATATAATGAGAAAACAAATATGCTATTATATGAGAGAAAATATAATGATGCTAGCCGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	30.50%	13.75%	2.81%	NA
All Indica	2759	71.90%	1.60%	21.96%	4.49%	NA
All Japonica	1512	11.00%	88.90%	0.07%	0.00%	NA
Aus	269	85.10%	0.40%	11.52%	2.97%	NA
Indica I	595	78.00%	0.80%	15.46%	5.71%	NA
Indica II	465	73.30%	2.60%	18.06%	6.02%	NA
Indica III	913	65.90%	1.10%	30.67%	2.30%	NA
Indica Intermediate	786	73.40%	2.30%	19.08%	5.22%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	25.20%	74.80%	0.00%	0.00%	NA
Japonica Intermediate	241	10.00%	89.60%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	13.50%	4.17%	0.00%	NA
Intermediate	90	45.60%	44.40%	8.89%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113976407	T -> DEL	N	N	silent_mutation	Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0113976407	T -> C	LOC_Os01g24810.1	upstream_gene_variant ; 1557.0bp to feature; MODIFIER	silent_mutation	Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0113976407	T -> C	LOC_Os01g24820.1	downstream_gene_variant ; 3478.0bp to feature; MODIFIER	silent_mutation	Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0113976407	T -> C	LOC_Os01g24800-LOC_Os01g24810	intergenic_region ; MODIFIER	silent_mutation	Average:18.642; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113976407	NA	1.58E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113976407	NA	1.12E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.99E-21	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.09E-21	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	6.14E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.48E-17	mr1361	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.35E-22	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.37E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.61E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	4.14E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.71E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	5.30E-15	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.68E-64	mr1711	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	9.89E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.15E-34	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	8.49E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	2.69E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	9.41E-19	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	2.78E-25	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	3.22E-35	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.21E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	4.47E-20	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	5.76E-15	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	6.82E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.70E-14	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	7.37E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.65E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113976407	NA	1.65E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251