Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113971432:

Variant ID: vg0113971432 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 13971432
Reference Allele: T	Alternative Allele: C,TC
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCAGGAGATTAGGAGGAAGGGGTTGACTTTAAAACAAATATAATTTAATGGTTAAAATAATTAGTCCATATTTAAAAGTGTTGGATGTATTTTTTTTC[T/C,TC]
AAGAATACACCAGTAATAAATTAACGGATGCGTTAGGATGGTTGTATAGGAGTGTCAATATATATAGGGCGTGTTCGATTGCTCGTATCTAGGTTGGCTC

Reverse complement sequence

GAGCCAACCTAGATACGAGCAATCGAACACGCCCTATATATATTGACACTCCTATACAACCATCCTAACGCATCCGTTAATTTATTACTGGTGTATTCTT[A/G,GA]
GAAAAAAAATACATCCAACACTTTTAAATATGGACTAATTATTTTAACCATTAAATTATATTTGTTTTAAAGTCAACCCCTTCCTCCTAATCTCCTGCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.50%	0.06%	0.00%	TC: 0.68%
All Indica	2759	91.70%	7.10%	0.11%	0.00%	TC: 1.16%
All Japonica	1512	8.50%	91.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.00%	14.60%	0.34%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	96.10%	1.00%	0.00%	0.00%	TC: 2.96%
Indica Intermediate	786	89.30%	9.90%	0.13%	0.00%	TC: 0.64%
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	20.40%	79.60%	0.00%	0.00%	NA
Japonica Intermediate	241	9.10%	90.90%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113971432	T -> TC	LOC_Os01g24800.1	downstream_gene_variant ; 1303.0bp to feature; MODIFIER	silent_mutation	Average:74.163; most accessible tissue: Callus, score: 89.461	N	N	N	N
vg0113971432	T -> TC	LOC_Os01g24800-LOC_Os01g24810	intergenic_region ; MODIFIER	silent_mutation	Average:74.163; most accessible tissue: Callus, score: 89.461	N	N	N	N
vg0113971432	T -> C	LOC_Os01g24800.1	downstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:74.163; most accessible tissue: Callus, score: 89.461	N	N	N	N
vg0113971432	T -> C	LOC_Os01g24800-LOC_Os01g24810	intergenic_region ; MODIFIER	silent_mutation	Average:74.163; most accessible tissue: Callus, score: 89.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113971432	NA	6.27E-16	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	4.44E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	3.08E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	2.15E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	1.31E-06	1.60E-67	mr1711	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	1.22E-23	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	1.60E-33	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	7.62E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	3.22E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	2.50E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	6.34E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	7.87E-81	mr1711_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	8.64E-06	mr1711_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	1.64E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	1.20E-12	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	3.10E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	4.75E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113971432	NA	4.75E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251