\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113946199:

Variant ID: vg0113946199 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13946199
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTATTGGATTCCATCATATGAAAATCCAATCATCGCCAAAACTACTTCACCAATAATCTCCAAATATCAATACTATTGTCCCATATGTTGTTGGATTC[T/A]
TGTTACTTGAACCATCGAACTGGTATAGCCTGTCCTCACCAATGCGAAAAGACGATCAAGAAAATCCAATGGTTCAAAAATCTACTCGATCTAAATCAAT

Reverse complement sequence

ATTGATTTAGATCGAGTAGATTTTTGAACCATTGGATTTTCTTGATCGTCTTTTCGCATTGGTGAGGACAGGCTATACCAGTTCGATGGTTCAAGTAACA[A/T]
GAATCCAACAACATATGGGACAATAGTATTGATATTTGGAGATTATTGGTGAAGTAGTTTTGGCGATGATTGGATTTTCATATGATGGAATCCAATAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.90% 0.11% 0.21% NA
All Indica  2759 50.70% 48.80% 0.18% 0.29% NA
All Japonica  1512 95.30% 4.70% 0.00% 0.00% NA
Aus  269 2.20% 97.40% 0.00% 0.37% NA
Indica I  595 51.30% 48.40% 0.34% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 33.40% 65.80% 0.33% 0.44% NA
Indica Intermediate  786 47.30% 52.20% 0.00% 0.51% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 47.90% 0.00% 1.04% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113946199 T -> A LOC_Os01g24780.1 downstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:37.661; most accessible tissue: Callus, score: 53.688 N N N N
vg0113946199 T -> A LOC_Os01g24780-LOC_Os01g24790 intergenic_region ; MODIFIER silent_mutation Average:37.661; most accessible tissue: Callus, score: 53.688 N N N N
vg0113946199 T -> DEL N N silent_mutation Average:37.661; most accessible tissue: Callus, score: 53.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113946199 NA 2.49E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 8.86E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 8.16E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 6.85E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 2.20E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 2.20E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 5.19E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 2.11E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 1.14E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 2.45E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 9.70E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 6.76E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 1.31E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 3.01E-06 1.42E-11 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 3.99E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 8.22E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113946199 NA 2.57E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251