\
| Variant ID: vg0113942268 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13942268 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )
TTAAACAACCTATCATAATATGAAACTCTTTTTATTTAAAACATCATAATTTTATAGATATTATTAGTCAAAGTAGCATCTCGGAGACTGTGTCAGAATC[C/T,A]
AAAAATACTTATATTTTAGGACAGATAAAGTAATTCTAGCTCGATCAACTGCGTGTTGTGTGTTACTGTCTTCTTCAAACCACGTAATTAGTCTTCTTTC
GAAAGAAGACTAATTACGTGGTTTGAAGAAGACAGTAACACACAACACGCAGTTGATCGAGCTAGAATTACTTTATCTGTCCTAAAATATAAGTATTTTT[G/A,T]
GATTCTGACACAGTCTCCGAGATGCTACTTTGACTAATAATATCTATAAAATTATGATGTTTTAAATAAAAAGAGTTTCATATTATGATAGGTTGTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.10% | 9.90% | 0.17% | 7.85% | A: 0.02% |
| All Indica | 2759 | 77.70% | 15.30% | 0.25% | 6.71% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 33.10% | 0.00% | 0.37% | 66.17% | A: 0.37% |
| Indica I | 595 | 78.80% | 16.50% | 0.50% | 4.20% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 71.20% | 20.30% | 0.22% | 8.32% | NA |
| Indica Intermediate | 786 | 73.90% | 15.30% | 0.25% | 10.56% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 86.70% | 5.60% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113942268 | C -> T | LOC_Os01g24770.1 | upstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:43.527; most accessible tissue: Callus, score: 73.374 | N | N | N | N |
| vg0113942268 | C -> T | LOC_Os01g24780.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.527; most accessible tissue: Callus, score: 73.374 | N | N | N | N |
| vg0113942268 | C -> A | LOC_Os01g24770.1 | upstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:43.527; most accessible tissue: Callus, score: 73.374 | N | N | N | N |
| vg0113942268 | C -> A | LOC_Os01g24780.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.527; most accessible tissue: Callus, score: 73.374 | N | N | N | N |
| vg0113942268 | C -> DEL | N | N | silent_mutation | Average:43.527; most accessible tissue: Callus, score: 73.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113942268 | 8.22E-07 | 2.78E-10 | mr1064 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 1.38E-06 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 2.63E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 3.87E-08 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 1.97E-06 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 4.87E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | 8.42E-06 | 3.74E-08 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113942268 | NA | 1.95E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |