\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113942268:

Variant ID: vg0113942268 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13942268
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAACAACCTATCATAATATGAAACTCTTTTTATTTAAAACATCATAATTTTATAGATATTATTAGTCAAAGTAGCATCTCGGAGACTGTGTCAGAATC[C/T,A]
AAAAATACTTATATTTTAGGACAGATAAAGTAATTCTAGCTCGATCAACTGCGTGTTGTGTGTTACTGTCTTCTTCAAACCACGTAATTAGTCTTCTTTC

Reverse complement sequence

GAAAGAAGACTAATTACGTGGTTTGAAGAAGACAGTAACACACAACACGCAGTTGATCGAGCTAGAATTACTTTATCTGTCCTAAAATATAAGTATTTTT[G/A,T]
GATTCTGACACAGTCTCCGAGATGCTACTTTGACTAATAATATCTATAAAATTATGATGTTTTAAATAAAAAGAGTTTCATATTATGATAGGTTGTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 9.90% 0.17% 7.85% A: 0.02%
All Indica  2759 77.70% 15.30% 0.25% 6.71% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 33.10% 0.00% 0.37% 66.17% A: 0.37%
Indica I  595 78.80% 16.50% 0.50% 4.20% NA
Indica II  465 95.70% 4.10% 0.00% 0.22% NA
Indica III  913 71.20% 20.30% 0.22% 8.32% NA
Indica Intermediate  786 73.90% 15.30% 0.25% 10.56% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 86.70% 5.60% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113942268 C -> T LOC_Os01g24770.1 upstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:43.527; most accessible tissue: Callus, score: 73.374 N N N N
vg0113942268 C -> T LOC_Os01g24780.1 intron_variant ; MODIFIER silent_mutation Average:43.527; most accessible tissue: Callus, score: 73.374 N N N N
vg0113942268 C -> A LOC_Os01g24770.1 upstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:43.527; most accessible tissue: Callus, score: 73.374 N N N N
vg0113942268 C -> A LOC_Os01g24780.1 intron_variant ; MODIFIER silent_mutation Average:43.527; most accessible tissue: Callus, score: 73.374 N N N N
vg0113942268 C -> DEL N N silent_mutation Average:43.527; most accessible tissue: Callus, score: 73.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113942268 8.22E-07 2.78E-10 mr1064 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 1.38E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 2.63E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 3.87E-08 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 1.97E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 4.87E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 8.42E-06 3.74E-08 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268 NA 1.95E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251