\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113935237:

Variant ID: vg0113935237 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13935237
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGATTATTTTTTCCGTGCGGTTAGGCTGCCCGTATGCGGAAATATTTATTTTCACAGACACCAGGGTGTAGGGTGTAGACGGGCAAGACCTCCGCA[T/C]
GGAAAAAAAACTTTTTGACCGCACGAAAAAAATCCTTTTAGTAGTAGTGAGCTAGTCAAAGTTGTCTGTTATTTGAAAACAGATCAGTGCAATGCTACAC

Reverse complement sequence

GTGTAGCATTGCACTGATCTGTTTTCAAATAACAGACAACTTTGACTAGCTCACTACTACTAAAAGGATTTTTTTCGTGCGGTCAAAAAGTTTTTTTTCC[A/G]
TGCGGAGGTCTTGCCCGTCTACACCCTACACCCTGGTGTCTGTGAAAATAAATATTTCCGCATACGGGCAGCCTAACCGCACGGAAAAAATAATCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 36.70% 8.10% 13.84% NA
All Indica  2759 52.50% 11.90% 13.52% 22.04% NA
All Japonica  1512 8.00% 89.50% 0.26% 2.25% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 56.50% 26.20% 1.68% 15.63% NA
Indica II  465 35.70% 12.50% 19.35% 32.47% NA
Indica III  913 55.10% 4.40% 20.92% 19.61% NA
Indica Intermediate  786 56.50% 9.50% 10.43% 23.54% NA
Temperate Japonica  767 1.00% 97.40% 0.00% 1.56% NA
Tropical Japonica  504 18.30% 77.20% 0.79% 3.77% NA
Japonica Intermediate  241 8.70% 90.00% 0.00% 1.24% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 33.30% 47.80% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113935237 T -> DEL N N silent_mutation Average:71.541; most accessible tissue: Callus, score: 93.192 N N N N
vg0113935237 T -> C LOC_Os01g24764.1 3_prime_UTR_variant ; 156.0bp to feature; MODIFIER silent_mutation Average:71.541; most accessible tissue: Callus, score: 93.192 N N N N
vg0113935237 T -> C LOC_Os01g24760.1 upstream_gene_variant ; 899.0bp to feature; MODIFIER silent_mutation Average:71.541; most accessible tissue: Callus, score: 93.192 N N N N
vg0113935237 T -> C LOC_Os01g24770.1 downstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:71.541; most accessible tissue: Callus, score: 93.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113935237 T C 0.04 0.02 0.02 0.03 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113935237 NA 6.54E-13 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113935237 NA 3.36E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113935237 NA 4.83E-18 mr1069 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.79E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.23E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 3.47E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 4.51E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 4.23E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 9.80E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.81E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.34E-22 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.58E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 3.73E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 1.22E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 2.27E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 4.19E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 5.17E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 4.29E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 4.82E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113935237 NA 2.74E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251