\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113887896:

Variant ID: vg0113887896 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13887896
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GATTGGTGATTGGGGATAGTGTGGGGATGCAGCTTGATGCCCAGATGTCTAATTCTTCCTTTTTAACTGTATTTTTTTTGGTAGATCTTTACCAAATAAA[C/A]
TGTATTTTTGGTAGAATTGGATGGGAGATCTCGAAGTTCTGTACAGTTTGGGTGTCCTAAGCAATACTTCGATTTTGGGGTTGTATACATTGATGCTATT

Reverse complement sequence

AATAGCATCAATGTATACAACCCCAAAATCGAAGTATTGCTTAGGACACCCAAACTGTACAGAACTTCGAGATCTCCCATCCAATTCTACCAAAAATACA[G/T]
TTTATTTGGTAAAGATCTACCAAAAAAAATACAGTTAAAAAGGAAGAATTAGACATCTGGGCATCAAGCTGCATCCCCACACTATCCCCAATCACCAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.70% 31.20% 0.99% 25.14% NA
All Indica  2759 16.50% 39.70% 1.56% 42.23% NA
All Japonica  1512 97.70% 2.20% 0.00% 0.13% NA
Aus  269 3.00% 95.50% 0.00% 1.49% NA
Indica I  595 18.70% 32.80% 0.50% 48.07% NA
Indica II  465 19.40% 9.50% 2.80% 68.39% NA
Indica III  913 11.80% 58.30% 1.75% 28.15% NA
Indica Intermediate  786 18.70% 41.20% 1.40% 38.68% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 28.10% 70.80% 0.00% 1.04% NA
Intermediate  90 53.30% 24.40% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113887896 C -> A LOC_Os01g24670.1 upstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 flower, score: 91.85 N N N N
vg0113887896 C -> A LOC_Os01g24660.1 downstream_gene_variant ; 4617.0bp to feature; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 flower, score: 91.85 N N N N
vg0113887896 C -> A LOC_Os01g24680.1 intron_variant ; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 flower, score: 91.85 N N N N
vg0113887896 C -> A LOC_Os01g24680.2 intron_variant ; MODIFIER silent_mutation Average:74.117; most accessible tissue: Zhenshan97 flower, score: 91.85 N N N N
vg0113887896 C -> DEL N N silent_mutation Average:74.117; most accessible tissue: Zhenshan97 flower, score: 91.85 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113887896 C A -0.02 -0.03 -0.03 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113887896 NA 7.41E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113887896 NA 1.49E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.36E-17 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 2.13E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 8.09E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 3.03E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 2.61E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.76E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 7.31E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 4.71E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 2.05E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.93E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.14E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.46E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.72E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 6.52E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 2.70E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 7.90E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 8.38E-12 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 5.84E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.01E-14 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 5.57E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.26E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 3.89E-20 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113887896 NA 1.07E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251