Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113855432:

Variant ID: vg0113855432 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13855432
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCGATGTTGACGACACCAACTGTGCAAATTCGAATCCCACACTGGAGTTCGGTACCCATACTACTGGAGAAAAAGGCTTTACTCCCGGTTGGAAACCC[C/T]
CCTATAGTCCCGGTTATACAACCGGGACTATGAATCTGGGACTAAATATACCCATCTTTAGTCCCGGGTGAATAACGAGGACTAAAAATCCATCTTTAGT

Reverse complement sequence

ACTAAAGATGGATTTTTAGTCCTCGTTATTCACCCGGGACTAAAGATGGGTATATTTAGTCCCAGATTCATAGTCCCGGTTGTATAACCGGGACTATAGG[G/A]
GGGTTTCCAACCGGGAGTAAAGCCTTTTTCTCCAGTAGTATGGGTACCGAACTCCAGTGTGGGATTCGAATTTGCACAGTTGGTGTCGTCAACATCGACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	31.00%	0.53%	17.48%	NA
All Indica	2759	31.90%	39.30%	0.87%	28.02%	NA
All Japonica	1512	95.00%	2.20%	0.00%	2.78%	NA
Aus	269	3.30%	95.90%	0.00%	0.74%	NA
Indica I	595	3.90%	32.30%	1.68%	62.18%	NA
Indica II	465	63.70%	9.00%	0.43%	26.88%	NA
Indica III	913	37.00%	57.20%	0.44%	5.37%	NA
Indica Intermediate	786	28.20%	41.60%	1.02%	29.13%	NA
Temperate Japonica	767	98.30%	0.10%	0.00%	1.56%	NA
Tropical Japonica	504	89.10%	5.80%	0.00%	5.16%	NA
Japonica Intermediate	241	97.10%	1.20%	0.00%	1.66%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	63.30%	25.60%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113855432	C -> T	LOC_Os01g24600.1	upstream_gene_variant ; 3830.0bp to feature; MODIFIER	silent_mutation	Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0113855432	C -> T	LOC_Os01g24590.1	downstream_gene_variant ; 2169.0bp to feature; MODIFIER	silent_mutation	Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0113855432	C -> T	LOC_Os01g24570-LOC_Os01g24590	intergenic_region ; MODIFIER	silent_mutation	Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N
vg0113855432	C -> DEL	N	N	silent_mutation	Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113855432	NA	5.13E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113855432	NA	6.56E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	8.62E-20	mr1277_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	3.99E-08	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	5.83E-06	mr1302_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	2.57E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.90E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.89E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	2.72E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	2.94E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.78E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.93E-07	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	7.92E-06	mr1577_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	9.46E-17	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	6.83E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	2.90E-06	mr1780_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.25E-11	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	3.98E-07	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	6.35E-15	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	5.07E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	1.57E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	2.80E-20	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432	NA	9.61E-07	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251