\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113855432:

Variant ID: vg0113855432 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13855432
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGATGTTGACGACACCAACTGTGCAAATTCGAATCCCACACTGGAGTTCGGTACCCATACTACTGGAGAAAAAGGCTTTACTCCCGGTTGGAAACCC[C/T]
CCTATAGTCCCGGTTATACAACCGGGACTATGAATCTGGGACTAAATATACCCATCTTTAGTCCCGGGTGAATAACGAGGACTAAAAATCCATCTTTAGT

Reverse complement sequence

ACTAAAGATGGATTTTTAGTCCTCGTTATTCACCCGGGACTAAAGATGGGTATATTTAGTCCCAGATTCATAGTCCCGGTTGTATAACCGGGACTATAGG[G/A]
GGGTTTCCAACCGGGAGTAAAGCCTTTTTCTCCAGTAGTATGGGTACCGAACTCCAGTGTGGGATTCGAATTTGCACAGTTGGTGTCGTCAACATCGACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 31.00% 0.53% 17.48% NA
All Indica  2759 31.90% 39.30% 0.87% 28.02% NA
All Japonica  1512 95.00% 2.20% 0.00% 2.78% NA
Aus  269 3.30% 95.90% 0.00% 0.74% NA
Indica I  595 3.90% 32.30% 1.68% 62.18% NA
Indica II  465 63.70% 9.00% 0.43% 26.88% NA
Indica III  913 37.00% 57.20% 0.44% 5.37% NA
Indica Intermediate  786 28.20% 41.60% 1.02% 29.13% NA
Temperate Japonica  767 98.30% 0.10% 0.00% 1.56% NA
Tropical Japonica  504 89.10% 5.80% 0.00% 5.16% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 63.30% 25.60% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113855432 C -> T LOC_Os01g24600.1 upstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0113855432 C -> T LOC_Os01g24590.1 downstream_gene_variant ; 2169.0bp to feature; MODIFIER silent_mutation Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0113855432 C -> T LOC_Os01g24570-LOC_Os01g24590 intergenic_region ; MODIFIER silent_mutation Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg0113855432 C -> DEL N N silent_mutation Average:57.782; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113855432 NA 5.13E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113855432 NA 6.56E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 8.62E-20 mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 3.99E-08 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 5.83E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 2.57E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.90E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.89E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 2.72E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 2.94E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.78E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.93E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 7.92E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 9.46E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 6.83E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 2.90E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.25E-11 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 3.98E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 6.35E-15 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 5.07E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 1.57E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 2.80E-20 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113855432 NA 9.61E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251