\
| Variant ID: vg0113850020 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13850020 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 99. )
CAATAGTTCCGGTTCCATTAAAACCAGAACTAAAACCGATTTTTAGTCCCAGTTAAAAAAATTTTGATCTTTAGTCCAGCTGGTTCATCCCCTGTCAGAG[A/G]
CATGTCAGGGGGCCGAAGATCTTTAGTCCTGGTTGATACTACCAACCGGGACTAAAGATTACTACTTTAGTCCCGGTTTGCAGTATCAACCGGGAGTAAA
TTTACTCCCGGTTGATACTGCAAACCGGGACTAAAGTAGTAATCTTTAGTCCCGGTTGGTAGTATCAACCAGGACTAAAGATCTTCGGCCCCCTGACATG[T/C]
CTCTGACAGGGGATGAACCAGCTGGACTAAAGATCAAAATTTTTTTAACTGGGACTAAAAATCGGTTTTAGTTCTGGTTTTAATGGAACCGGAACTATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 46.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 25.00% | 74.70% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.70% | 77.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 5.40% | 94.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 34.10% | 65.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 27.90% | 71.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 46.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113850020 | A -> G | LOC_Os01g24570.1 | upstream_gene_variant ; 984.0bp to feature; MODIFIER | silent_mutation | Average:46.187; most accessible tissue: Callus, score: 69.757 | N | N | N | N |
| vg0113850020 | A -> G | LOC_Os01g24570-LOC_Os01g24590 | intergenic_region ; MODIFIER | silent_mutation | Average:46.187; most accessible tissue: Callus, score: 69.757 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113850020 | NA | 3.73E-08 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 6.52E-09 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.28E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.04E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 3.07E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 7.72E-11 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.45E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 5.88E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 2.17E-11 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 4.00E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 8.15E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 7.07E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 7.67E-09 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 2.83E-10 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.54E-29 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.13E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 2.58E-07 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 3.37E-09 | mr1761 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.62E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 1.36E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 3.17E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 5.90E-07 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113850020 | NA | 5.58E-21 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |