Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113820276:

Variant ID: vg0113820276 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 13820276
Reference Allele: A	Alternative Allele: T,ATTT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.03, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

TGATTTTTCTCCTAAATTACTTTTGATCCGATTACACCATTAAATTCATTGCAATTAAATCTTCAAAACAAGACCACACATGGATATATTCTTACGAAAA[A/T,ATTT]
TTTTTTTTGTTTATTATTGAATTATTTTTAAATGTTGCGCGATGTTCCACCAGGTATATCAGAATTATTTCACTAAGTAGATCGAAAATGTTTCACTCGT

Reverse complement sequence

ACGAGTGAAACATTTTCGATCTACTTAGTGAAATAATTCTGATATACCTGGTGGAACATCGCGCAACATTTAAAAATAATTCAATAATAAACAAAAAAAA[T/A,AAAT]
TTTTCGTAAGAATATATCCATGTGTGGTCTTGTTTTGAAGATTTAATTGCAATGAATTTAATGGTGTAATCGGATCAAAAGTAATTTAGGAGAAAAATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.70%	24.10%	1.50%	29.71%	ATTT: 0.04%
All Indica	2759	45.10%	8.00%	0.62%	46.21%	NA
All Japonica	1512	51.80%	42.20%	3.17%	2.84%	NA
Aus	269	3.30%	87.00%	0.74%	8.92%	NA
Indica I	595	74.50%	5.20%	0.67%	19.66%	NA
Indica II	465	34.00%	1.70%	1.08%	63.23%	NA
Indica III	913	38.20%	9.50%	0.11%	52.14%	NA
Indica Intermediate	786	37.50%	12.20%	0.89%	49.36%	NA
Temperate Japonica	767	25.90%	67.70%	4.56%	1.83%	NA
Tropical Japonica	504	83.50%	10.30%	1.19%	4.96%	NA
Japonica Intermediate	241	67.60%	27.80%	2.90%	1.66%	NA
VI/Aromatic	96	32.30%	17.70%	0.00%	47.92%	ATTT: 2.08%
Intermediate	90	47.80%	30.00%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113820276	A -> T	LOC_Os01g24500.1	downstream_gene_variant ; 3212.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> T	LOC_Os01g24510.1	downstream_gene_variant ; 2486.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> T	LOC_Os01g24520.1	downstream_gene_variant ; 3665.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> T	LOC_Os01g24500-LOC_Os01g24510	intergenic_region ; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> DEL	N	N	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> ATTT	LOC_Os01g24500.1	downstream_gene_variant ; 3213.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> ATTT	LOC_Os01g24510.1	downstream_gene_variant ; 2485.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> ATTT	LOC_Os01g24520.1	downstream_gene_variant ; 3664.0bp to feature; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N
vg0113820276	A -> ATTT	LOC_Os01g24500-LOC_Os01g24510	intergenic_region ; MODIFIER	silent_mutation	Average:32.944; most accessible tissue: Callus, score: 69.72	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113820276	NA	8.12E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820276	NA	1.70E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820276	NA	4.32E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820276	NA	5.02E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	3.99E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	9.52E-10	mr1030	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	5.67E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	8.70E-06	mr1046	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.05E-07	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	5.14E-09	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	3.61E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	6.16E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.61E-06	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	5.08E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.99E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	6.14E-07	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	3.79E-08	mr1520	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	6.29E-07	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.06E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.48E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	7.93E-10	mr1614	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	3.87E-08	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.21E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	7.92E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.09E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.21E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.05E-08	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.73E-08	mr1937	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.61E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	1.25E-06	mr1965	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.26E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	9.00E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.05E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.48E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	6.60E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	8.19E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.14E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	2.77E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	6.12E-06	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	3.60E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820276	NA	7.89E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251