\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113805813:

Variant ID: vg0113805813 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13805813
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.29, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGGATGCAAACGGCAGCCCAGTACCAATCAAGGGTTTGAGTGAAACCTGATCACATAAGACTGACAATTCAAGGCATAGTCCATTGTTTAGTTGTGGT[T/C]
TGATGTAGCTCATTTCCTAGGTGGAAGTTCAACTTAACAGTCTCCACCAAAACACTGGTATATCAAACAGGCACAACTTTGAGAACATTTCTTATGAGCC

Reverse complement sequence

GGCTCATAAGAAATGTTCTCAAAGTTGTGCCTGTTTGATATACCAGTGTTTTGGTGGAGACTGTTAAGTTGAACTTCCACCTAGGAAATGAGCTACATCA[A/G]
ACCACAACTAAACAATGGACTATGCCTTGAATTGTCAGTCTTATGTGATCAGGTTTCACTCAAACCCTTGATTGGTACTGGGCTGCCGTTTGCATCCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 17.70% 10.52% 35.76% NA
All Indica  2759 6.90% 19.80% 15.98% 57.34% NA
All Japonica  1512 94.60% 2.80% 0.79% 1.72% NA
Aus  269 3.70% 88.10% 2.60% 5.58% NA
Indica I  595 6.90% 22.00% 17.65% 53.45% NA
Indica II  465 6.50% 1.90% 24.30% 67.31% NA
Indica III  913 8.00% 23.00% 11.94% 57.06% NA
Indica Intermediate  786 5.70% 25.10% 14.50% 54.71% NA
Temperate Japonica  767 97.00% 1.80% 0.13% 1.04% NA
Tropical Japonica  504 89.70% 5.20% 2.18% 2.98% NA
Japonica Intermediate  241 97.50% 1.20% 0.00% 1.24% NA
VI/Aromatic  96 29.20% 1.00% 30.21% 39.58% NA
Intermediate  90 47.80% 11.10% 8.89% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113805813 T -> DEL N N silent_mutation Average:8.483; most accessible tissue: Callus, score: 15.676 N N N N
vg0113805813 T -> C LOC_Os01g24480.1 upstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:8.483; most accessible tissue: Callus, score: 15.676 N N N N
vg0113805813 T -> C LOC_Os01g24490.1 downstream_gene_variant ; 1710.0bp to feature; MODIFIER silent_mutation Average:8.483; most accessible tissue: Callus, score: 15.676 N N N N
vg0113805813 T -> C LOC_Os01g24480-LOC_Os01g24490 intergenic_region ; MODIFIER silent_mutation Average:8.483; most accessible tissue: Callus, score: 15.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113805813 NA 2.74E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 3.05E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 9.14E-10 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 3.05E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 1.13E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 2.78E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 5.30E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 8.05E-07 8.78E-06 mr1749 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 4.05E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813 NA 8.66E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251