\
| Variant ID: vg0113805813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13805813 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.29, others allele: 0.00, population size: 68. )
AGGGGATGCAAACGGCAGCCCAGTACCAATCAAGGGTTTGAGTGAAACCTGATCACATAAGACTGACAATTCAAGGCATAGTCCATTGTTTAGTTGTGGT[T/C]
TGATGTAGCTCATTTCCTAGGTGGAAGTTCAACTTAACAGTCTCCACCAAAACACTGGTATATCAAACAGGCACAACTTTGAGAACATTTCTTATGAGCC
GGCTCATAAGAAATGTTCTCAAAGTTGTGCCTGTTTGATATACCAGTGTTTTGGTGGAGACTGTTAAGTTGAACTTCCACCTAGGAAATGAGCTACATCA[A/G]
ACCACAACTAAACAATGGACTATGCCTTGAATTGTCAGTCTTATGTGATCAGGTTTCACTCAAACCCTTGATTGGTACTGGGCTGCCGTTTGCATCCCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.00% | 17.70% | 10.52% | 35.76% | NA |
| All Indica | 2759 | 6.90% | 19.80% | 15.98% | 57.34% | NA |
| All Japonica | 1512 | 94.60% | 2.80% | 0.79% | 1.72% | NA |
| Aus | 269 | 3.70% | 88.10% | 2.60% | 5.58% | NA |
| Indica I | 595 | 6.90% | 22.00% | 17.65% | 53.45% | NA |
| Indica II | 465 | 6.50% | 1.90% | 24.30% | 67.31% | NA |
| Indica III | 913 | 8.00% | 23.00% | 11.94% | 57.06% | NA |
| Indica Intermediate | 786 | 5.70% | 25.10% | 14.50% | 54.71% | NA |
| Temperate Japonica | 767 | 97.00% | 1.80% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 89.70% | 5.20% | 2.18% | 2.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 29.20% | 1.00% | 30.21% | 39.58% | NA |
| Intermediate | 90 | 47.80% | 11.10% | 8.89% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113805813 | T -> DEL | N | N | silent_mutation | Average:8.483; most accessible tissue: Callus, score: 15.676 | N | N | N | N |
| vg0113805813 | T -> C | LOC_Os01g24480.1 | upstream_gene_variant ; 1023.0bp to feature; MODIFIER | silent_mutation | Average:8.483; most accessible tissue: Callus, score: 15.676 | N | N | N | N |
| vg0113805813 | T -> C | LOC_Os01g24490.1 | downstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:8.483; most accessible tissue: Callus, score: 15.676 | N | N | N | N |
| vg0113805813 | T -> C | LOC_Os01g24480-LOC_Os01g24490 | intergenic_region ; MODIFIER | silent_mutation | Average:8.483; most accessible tissue: Callus, score: 15.676 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113805813 | NA | 2.74E-09 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 3.05E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 9.14E-10 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 3.05E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 1.13E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 2.78E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 5.30E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | 8.05E-07 | 8.78E-06 | mr1749 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 4.05E-06 | mr1749 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113805813 | NA | 8.66E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |