\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113767498:

Variant ID: vg0113767498 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13767498
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAATACCTCCGGGTTACTGGGAGGTATAGGGTTAACGCAGAGGATGTAAGTCTCTCGACTCAACGTACAAGTCTATTGGACCACTACACTTATGAATC[G/A]
TACTAATGTATTATCATTCTTTCGTGTAAACAGTTGCCTAGTATTGAGCGTCGAGAAGGATTCGACGATATGAGCATTAAAAATGTGCAACAGGACCTCT

Reverse complement sequence

AGAGGTCCTGTTGCACATTTTTAATGCTCATATCGTCGAATCCTTCTCGACGCTCAATACTAGGCAACTGTTTACACGAAAGAATGATAATACATTAGTA[C/T]
GATTCATAAGTGTAGTGGTCCAATAGACTTGTACGTTGAGTCGAGAGACTTACATCCTCTGCGTTAACCCTATACCTCCCAGTAACCCGGAGGTATTCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 26.20% 1.69% 26.43% NA
All Indica  2759 23.20% 29.90% 2.75% 44.15% NA
All Japonica  1512 95.00% 4.70% 0.13% 0.20% NA
Aus  269 2.20% 95.50% 0.00% 2.23% NA
Indica I  595 29.20% 23.50% 2.02% 45.21% NA
Indica II  465 29.00% 7.10% 3.44% 60.43% NA
Indica III  913 18.60% 41.90% 1.86% 37.57% NA
Indica Intermediate  786 20.60% 34.10% 3.94% 41.35% NA
Temperate Japonica  767 98.30% 1.30% 0.26% 0.13% NA
Tropical Japonica  504 88.90% 10.90% 0.00% 0.20% NA
Japonica Intermediate  241 97.10% 2.50% 0.00% 0.41% NA
VI/Aromatic  96 27.10% 71.90% 0.00% 1.04% NA
Intermediate  90 54.40% 20.00% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113767498 G -> A LOC_Os01g24410.1 downstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:25.09; most accessible tissue: Callus, score: 63.028 N N N N
vg0113767498 G -> A LOC_Os01g24420.1 intron_variant ; MODIFIER silent_mutation Average:25.09; most accessible tissue: Callus, score: 63.028 N N N N
vg0113767498 G -> DEL N N silent_mutation Average:25.09; most accessible tissue: Callus, score: 63.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113767498 NA 8.84E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 4.01E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 3.66E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 2.83E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 7.70E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 2.52E-09 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 2.02E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 1.59E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 1.30E-18 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 4.73E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 2.24E-10 mr1574 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 6.98E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 7.44E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 8.24E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 2.23E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 6.66E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113767498 NA 1.71E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251