\
| Variant ID: vg0113766179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13766179 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )
GCAATGGGATGAAGCAGAACCGGACATCTATAAGGACCCAAATCCTGCAAAGGACCCTGTTGAGGAGACCCTCGTGAATGACACGGCCAAAGATAAGTCT[G/A]
AAGTGCCTAGAGTACTCAGAAGCCACGACTCCAAGAAAAAGGATGAACACAAGGAGAAGTACATGGTAAGCGTCTTCAAGGGGGCAAGGAAAGAGCACTA
TAGTGCTCTTTCCTTGCCCCCTTGAAGACGCTTACCATGTACTTCTCCTTGTGTTCATCCTTTTTCTTGGAGTCGTGGCTTCTGAGTACTCTAGGCACTT[C/T]
AGACTTATCTTTGGCCGTGTCATTCACGAGGGTCTCCTCAACAGGGTCCTTTGCAGGATTTGGGTCCTTATAGATGTCCGGTTCTGCTTCATCCCATTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 14.30% | 1.54% | 35.25% | NA |
| All Indica | 2759 | 28.70% | 14.20% | 2.32% | 54.84% | NA |
| All Japonica | 1512 | 95.00% | 2.60% | 0.20% | 2.25% | NA |
| Aus | 269 | 3.00% | 87.00% | 0.37% | 9.67% | NA |
| Indica I | 595 | 30.90% | 21.50% | 1.01% | 46.55% | NA |
| Indica II | 465 | 30.10% | 1.30% | 1.72% | 66.88% | NA |
| Indica III | 913 | 26.40% | 13.30% | 1.64% | 58.71% | NA |
| Indica Intermediate | 786 | 28.80% | 17.30% | 4.45% | 49.49% | NA |
| Temperate Japonica | 767 | 98.30% | 1.30% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 88.90% | 5.20% | 0.00% | 5.95% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 29.20% | 2.10% | 2.08% | 66.67% | NA |
| Intermediate | 90 | 54.40% | 10.00% | 3.33% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113766179 | G -> A | LOC_Os01g24420.1 | missense_variant ; p.Glu71Lys; MODERATE | nonsynonymous_codon ; E71K | Average:27.272; most accessible tissue: Callus, score: 74.166 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0113766179 | G -> DEL | LOC_Os01g24420.1 | N | frameshift_variant | Average:27.272; most accessible tissue: Callus, score: 74.166 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113766179 | NA | 4.33E-09 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | 6.57E-06 | 1.98E-06 | mr1030 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 9.88E-08 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 2.13E-07 | mr1190 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 2.88E-07 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | 5.55E-06 | NA | mr1206 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.34E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.56E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.57E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.14E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.69E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 5.35E-10 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 2.54E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.83E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 6.46E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 1.70E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113766179 | NA | 2.51E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |